help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oyesiku, N. M.
Right arrow Articles by Parks, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oyesiku, N. M.
Right arrow Articles by Parks, J. S.
The Journal of Clinical Endocrinology & Metabolism Vol. 82, No. 12 4184-4188
Copyright © 1997 by The Endocrine Society

Original Studies

Pituitary Adenomas: Screening for G{alpha}q Mutations

Nelson M. Oyesiku, Chheng-Orn Evans, Milton R. Brown, Lewis S. Blevins, George T. Tindall and John S. Parks

Department of Neurosurgery and Laboratory of Molecular Neurosurgery and Biotechnology (N.M.O., C.-O.E., G.T.T.), Division of Pediatric Endocrinology and Department of Pediatrics (M.R.B., J.S.P.), Division of Endocrinology (L.S.B.), Department of Medicine, Emory University School of Medicine, Atlanta, Georgia 30322

Address all correspondence and requests for reprints to: Dr. Nelson M. Oyesiku, Section of Neurosurgery, The Emory Clinic, Inc., 1365 Clifton Road, N. E., Building B, Suite B2200, Atlanta, Georgia 30322. E-mail: noyesik{at}emory.edu


   Abstract
Top
 Abstract
Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Mutant, guanosine triphosphatase-deficient, {alpha}-subunits of the G protein, Gs, gsp ocogene have been discovered in 40% of GH-secreting pituitary adenomas. Therefore, we hypothesized that a novel G protein class, G{alpha}q, involved in pituitary signal transduction, might be involved in pituitary tumorigenesis. Recombinant mutations of G{alpha}q result in constitutive activation of phospholipase C and have transforming activity. Therefore, we screened tumor samples from 37 pituitary adenomas for the presence of activating mutations of the G{alpha}q gene. Importantly, our sample contains 8 FSH and LH adenomas. In the pituitary gland, FSH and LH are linked to the GnRH-G{alpha}q signaling cascade, making these tumors a logical choice for screening for G{alpha}q mutations. Complementary DNA (cDNA) was synthesized by RT-PCR with G{alpha}q specific primers to exclude pseudogene transcripts. Fragments of G{alpha}q cDNA-encompassing residues (Arg183, Gln209) were screened by single-strand conformation polymorphism and then sequenced in both directions. No mutations were detected. We conclude that mutations in these regions of the G{alpha}q cDNA occur infrequently, if at all, in human pituitary adenomas. Alternative mechanisms underlying pituitary tumorigenesis should be explored.


   Introduction
Top
 Abstract
 Introduction
Subjects and Methods
 Results
 Discussion
 References
 
THE G proteins are a family of guanine-nucleotide-binding proteins that relay signals from cell surface receptors to intracellular effectors. These proteins are heterotrimers composed of {alpha}, ß {gamma}-subunits (1). The {alpha}-subunit is believed to confer receptor and effector specificity on the heterotrimer. When the G protein is activated by interaction with receptor, the {alpha}-subunit exchanges bound guanosine diphosphate for guanosine triphosphate (GTP). The intrinsic GTPase activity of the {alpha}-subunit restores it to the basal state in which guanosine diphosphatephos is bound. At least three {alpha}-subunits (Gs, Gi, and more recently, Gq) have been involved in pituitary cell signaling. Gs is involved in the GHRH-adenyl cyclase (AC)-cAMP pathway. Gi is involved in the SRIH-AC-cAMP pathway. A novel class, Gq (G{alpha}q and G{alpha}11) has been identified as the G protein that mediates the TRH and GnRH signal cascades in pituitary cells (2, 3). These pathways are mediated by phospholipase C (PLC) and the inositol phospholipids. G{alpha}q and G{alpha}11 differ at only four residues over the C-terminal 144 amino acids, which contains the structural elements required for specific interactions with effector and receptor.

The most specific molecular abnormality in pituitary tumors identified to date is a mutation of the G protein, Gs(4). Indeed, 2 single-point mutations in the G{alpha}s-subunit (arginine-201 and glutamine-227) give rise to the gsp oncogene. This mutant G{alpha}s results in constitutive activity of AC and high levels of cAMP and occurs in about 40% of somatotroph adenomas and the McCune-Albright syndrome (4, 5, 6, 7, 8, 9, 10, 11, 12). In a similar vein, G{alpha}q may be a candidate oncogene. Recombinant mutations G{alpha}q (R183C and Q209L) result in constitutive activity of PLC and increased inositol phospholipid turnover in transfected cells. Furthermore, G{alpha}q Q209L mutations induce malignant transformation when expressed in NIH 3T3 cells (13, 14). However, there are no reports of G{alpha}q mutations in pituitary tumors. Therefore, we screened samples from 37 pituitary tumors for the presence of activating somatic mutations within the GTPase catalytic domain of the G{alpha}q genes, using single-strand conformation polymorphism (SSCP) of RT-PCR product, and direct DNA sequencing. Importantly, our sample contains 8 FSH and LH adenomas. In the pituitary gland, FSH and LH are linked to the GnRH-G{alpha}q signaling cascade, making these tumors a logical choice for screening for G{alpha}q mutations.


   Subjects and Methods
Top
 Abstract
 Introduction
 Subjects and Methods
Results
 Discussion
 References
 
Patients

Clinical and pathological data from the 37 patients are shown in Table 1Go. There were 22 males and 15 females ranging from ages 26–90 yr. The tumors consisted of 30 clinically nonfunctional tumors (including 8 FSH and LH tumors), 3 GH-secreting adenomas (acromegaly), 2 PRL-secreting adenomas, 1 ACTH-secreting adenoma (Cushing’s disease), and 1 case of pituitary apoplexy. Pituitary tumor specimens were obtained during surgery performed at Emory University Hospital under an approved informed consent protocol. All tumors were macroadenomas. Specimens were immediately frozen in liquid nitrogen and stored at -80 C until analyzed.


View this table:
[in this window]
[in a new window]
  		Table 1. Clinical and pathological characteristics of pituitary tumors

 
Purification of total RNA from pituitary tumor samples

Total RNA was isolated using an RNAgents Total RNA Isolation System (Promega, Madison, WI). In general, 50–60 mg of frozen pituitary tumor tissue was homogenized in 600–720 µL of the denaturing solution; 60–72 µL of 2 mol/L sodium acetate (pH 4.0) was added and mixed thoroughly. Two phenol:chloroform:isoamyl alcohol extractions were performed; the aqueous phase was collected. The RNA was isopropanol precipitated at -20 C overnight. After centrifugation at 12,000 x g for 15' at 4 C, the pellet was dissolved in 100 µL of 0.5% SDS, 10 mmol/L EDTA, and then ethanol precipitated. After centrifugation, the pellet was washed with 75% ice-cold ethanol, dried briefly in a speed vac, and resuspended in 30–40 µL diethyl pyrocarbonate-treated water. The purity and quantity of RNA was analyzed spectrophotometrically.

RT-PCR and SSCP analysis

Primers were designed using Primer Select software (Lasergene, Madison, WI) and the human G{alpha}q complementary DNA (cDNA) sequence (15). To avoid amplifying the G{alpha}q pseudogene, which is highly homologous to human G{alpha}q cDNA, we designed a pair of primers (20 oligonucleotides) that flanked the GTPase catalytic domain from codon A168 to D243, which had 3' mismatches with the pseudogene sequence. The sense-strand primer also was designed such that it contained a contiguous eight-base mismatch with the peudogene sequence:

The sense primer was 5'AGCTGACCCTGCCTACCTGC 3', and the antisense primer was 5' GTCTGACTCCACGAGAACTT 3'. This set of primers amplified the 229-bp G{alpha}q cDNA flanking the catalytic domain. The oligonucleotide primers were synthesized by Emory University Microchemical Facility, Winship Cancer Center.

For the RT reaction, we used the first-strand cDNA synthesis kit (Boehringer Mannheim, Indianapolis, IN); total RNA (2.5 µg) was reverse transcribed in a 10-µL reaction in 10 mmol/L Tris, 50 mmol/L KCl (pH 8.3), 5 mmol/L MgCl2, 1 mmol/L deoxynucleotide mix, 1.0 µmol/L antisense primer, 15 U RNase inhibitor, and 12.5 U of AMV RT. The total RNA was incubated at 65 C for 15 min and cooled in ice for 5 min, the enzymes were added, and the mixture was incubated at room temperature for 10 min and then at 42 C for 60 min.

The PCR was performed in a 50-µL reaction with the final concentration of all components as follows: 10 mmol/L Tris, 50 mmol/L KCl (pH 8.3), 2.5 mmol/L MgCl2, 0.2 mmol/L deoxynucleotide mix, 0.2 µmol/L of both primers, 2.5 U of Taq polymerase (Boehringer Mannheim), and 4 µCi of {alpha}-32PdCTP (3000 Ci/mmol). PCR was then performed at the following conditions: 94 C for 2 min followed by 94 C, 30 sec; 60 C, 30 sec; 72 C, 30 sec for 30 cycles.

The PCR product was diluted 1:10 in loading dye and then denatured, chilled, and loaded. Electrophoresis of 3 µL of the denatured sample was performed through a 0.5 XMDE gel (J. T. Baker Inc., Phillipsburg, NJ) at 5 watts at room temperature for 18 h. The gel was dried and exposed to film with intensifying screen at -80 C for 48 h.

RT-PCR and sequencing of G{alpha}q c DNA

The same set of primers described above was used to amplify and sequence, in both directions, the 229-bp G{alpha}q cDNA flanking the catalytic domain from codon A168 to D243. Total RNA (5 µg) from each sample was subjected to RT as described above. The PCR was performed, as previously described, except for 33 cycles and without {alpha} 32P dCTP (cytosine triphosphate).

Before sequencing, RT-PCR product was purified by eluting from agarose gel using the Wizard PCR preps DNA purification system (Promega). After precipitation and resuspension in 25 µL of water, the DNA (5 µL) was used for double-strand cycle sequencing (GIBCO/BRL, Gaithersburg, MD). The primers were 5' end labeled with {gamma}33P-ATP (2000 Ci/mmol) and T4 polynucleotide kinase. The direct cycle sequencing reactions were set up as recommended by the manufacturer, except for the addition of 5 pmols of each labeled primer, 2.5 U of Taq Polymerase, and 10% dimethyl sulfoxide (Sigma). The sequencing reaction was performed at the following cycles: 94 C for 2' followed by 94 C, 30"; 60 C, 30"; 72 C, 60" for 20 cycles and then 94 C, 30"; 72 C, 60" for 15 cycles. The sequencing reactions were denatured and resolved on a 6% denaturing polyacrylamide sequencing gel. The dried gel was exposed to film with intensifying screen at -80 C for 1–2 days.


   Results
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
Discussion
 References
 
RT-PCR and SSCP analysis for screening of G{alpha}q mutations

We used two strategies to eliminate the possibility of amplifying the human G{alpha}q pseudogene that is highly homologous to human G{alpha}q cDNA. First, the oligonucleotide primers (20 bases) were designed to have their 3'-ends mismatched with the pseudogene sequence; and second, we designed the sense-strand primer such that it makes an eight-base mismatch with the pseudogene sequence. This pair of primers selectively amplified the 229-bp G{alpha}q cDNA flanking the GTPase catalytic domain from A168 to D243 and encompassing the target codons of R183 and Q209 (Fig. 1Go). To further test the specificity of the primers, we sequenced the RT-PCR products from both directions and found that the sequence of the product was identical to the sequence of the published G{alpha}q cDNA (15) with a nucleotide C at position 562, A at 610, G at 613, G at 652, and A at 752. The corresponding pseudogene nucleotides are, respectively: G, G, A, T, and G. Sequencing from antisense primer also revealed the existence of eight bases: 5' CCTGCCTA 3'. These bases are present in the G{alpha}q cDNA but absent in pseudogene sequence. Therefore, we conclude that this set of primers specifically amplifies the G{alpha}q cDNA product of 229 bp and reliably excludes the pseudogene product.



View larger version (22K):
[in this window]
[in a new window]
  		Figure 1. Schematic representation of amino acids, regions of putative mutations, and primers for human G{alpha}q cDNA. The GTP-binding domain (horizontal bars) and GTP-ase domain (cross-hatch) and surrounding residues, including sites of recombinant mutations of G{alpha}q (R183C and Q209L), are shown. Sequences of both primers are also shown. This pair of primers selectively amplify the 229-bp cDNA flanking both domains spanning codon A168 to D243 and encompassing the target codons R183 and Q209. The relative locations of the PCR primers are indicated by arrows. The lower case letters in the primers set represent nucleotides that mismatch with the pseudogene sequence. This strategy is discussed further in the Subjects and Methods section.

 
To exclude the possibility of DNA contamination in RNA preparation, a control PCR amplification was performed with RNA templates but without RT. No product was obtained in these control experiments, whereas RT-PCR (with the same RNA samples under similar reaction conditions) yielded the expected 229-bp product.

Thirteen pituitary tumor samples were examined by SSCP analysis of RT-PCR products. We found no alteration in mobility shifts in the SSCP analysis from any of the tumor samples. To insure that we had not missed any mutations by SSCP analysis, the G{alpha}q cDNA product from all tumor samples was analyzed by direct sequencing.

RT-PCR and sequencing of G{alpha}q cDNA flanking the GTPase domain

Because SSCP analysis is not 100% reliable in detecting point mutations, we did not use this as a screening or a definitive method for detecting mutations, rather we performed direct cycle sequencing of RT-PCR products from all tumor samples.

G{alpha}q cDNAs flanking the GTPase domain were successfully amplified from all 37 pituitary tumors and 2 normal pituitaries, yielding RT-PCR products of the expected size (229 bp), as shown in the ethidium bromide agarose gel in Fig. 2Go. RT-PCR products were eluted from the agarose gel, precipitated, and directly sequenced in both directions with 33P 5'-end-labeled primers. Representative results for the G{alpha}q cDNA at Arg183 and Gln209 are shown in Fig. 3Go. As in the published human G{alpha}q cDNA from temporal cortex sequence cDNA (15), our sequencing clearly revealed that Arg183 in the human G{alpha}q cDNA from 2 normal pituitaries or from 37 pituitary tumors is coded by CGA, and Gln209 by CAA. None of the presumed activating mutations at codons Arg183 and Gln209 were detected. Furthermore, no alteration in the codons surrounding residues within the GTPase catalytic domain between codons A168 and D243 was detected.



View larger version (95K):
[in this window]
[in a new window]
  		Figure 2. Ethidium bromide-stained agarose gel of RT-PCR products from pituitary tumors. Lane 1 = 123-bp DNA ladder; lane 2, negative control; lanes 3–12, representative of RT-PCR products of 1 µg total RNA from 10 different pituitary tumors. The 229-bp product is reliably detectable under the conditions described in Subjects and Methods.

 


View larger version (77K):
[in this window]
[in a new window]
  		Figure 3. Sequencing of G{alpha}q cDNA. Left panel, Representative sequencing autoradiograph of G{alpha}q cDNA from 33P double-strand cycle sequencing of a pituitary adenoma at codon Arg183 and the surrounding nucleotides. Arg183 is coded by CGA. The sequence is identical to the published human cDNA sequence. Right panel, Representative sequencing autoradiograph of G{alpha}q cDNA from 33P double-strand cycle sequencing of a pituitary adenoma at codon Gln209 and the surrounding nucleotides. Gln209 is coded by CAA. The sequence is identical to the published human cDNA sequence.

 

   Discussion
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
References
 
In this study, we tested the hypothesis that mutant genes encoding G protein {alpha}-subunit (G{alpha}q) might be involved in the pathogenesis of pituitary tumors. The search for G{alpha}q mutations at these loci was stimulated by prior recombinant experiments, in which G{alpha}q mutations were genetically engineered at analogous residues to the G{alpha}s oncogene, which has been found in a subset of pituitary adenomas (4, 11). These recombinant mutants include: 1) R183C, an arginine 183-to-cysteine conversion that activates phosphoinositide-specific PLC (14, 16); and 2) Q209L, a glutamine 209-to-leucine mutant that also persistently activates phosphoinositide-specific PLC. Furthermore, when this mutant is expressed in NIH 3T3 cells, the cells are transformed, as assessed by focus formation or the soft agar colony formation assay. However, to date, none of these recombinant mutants (or indeed, any G{alpha}q mutants) have been found in pituitary tumors. A previous study had exclusively analyzed 8 TSH tumors, which are also linked to G{alpha}q in pituitary cell signaling (17). No mutations were found. Our study analyzed 37 pituitary tumors of various types, and most importantly, the samples in this study include 8 FSH and LH tumors. GnRH is the releasing hormone for FSH and LH and is linked to G{alpha}q in pituitary cell signaling (3). FSH and LH tumors, thus, are the only hormone-secreting tumors, other than TSH tumors, most likely to harbor G{alpha}q mutations. Furthermore, FSH and LH tumors are more prevalent than TSH tumors, because they probably account for the majority of clinically nonfunctioning pituitary adenomas (18). Despite these tantalizing prospects, our results from direct DNA sequencing of 37 tumor samples, and those of Dong et al. (17), in 8 TSH adenomas argue strongly against the possibility that G{alpha}q is a significant factor in pituitary tumorigenesis, because there were no mutations in the sequences encoding Arg183 or Gln209 or the surrounding bases in the conserved GTP-binding and hydrolysis domains.

The use of RT-PCR to screen for dominant oncogenic mutations is based on the assumption that tumor cells express the mutant allele at levels comparable with those of the normal allele. The quality of the cycle sequencing data, generated in both directions for regions of interest in G{alpha}q, makes it unlikely that a heterozygous mutant allele would have gone undetected, even if small proportions of normal tissue had unintentionally been included during surgical resection of the tumor samples. SSCP of double-stranded DNA fragments through a nondenaturing MDE gel also is regarded as a highly reliable method for detection of heterozygous mutations. SSCP has proven successful in detecting single-base substitutions in other G protein-coupled receptor genes (17). The sensitivity of the procedure used here for screening the G{alpha}q coding sequences was validated by direct sequencing.

In contrast to somatotroph adenomas, very little is known about the pathogenesis of clinically nonfunctional, TSH-, FSH-, or LH-secreting pituitary tumors. The failure to detect known activating mutations of the G{alpha}q leaves open the search for alternative mechanisms underlying adenoma formation. Although we have excluded those recombinant mutations known to impair GTPase activity in G{alpha}q as a common cause of pituitary tumors, we have not excluded the possibility that activating mutations exist elsewhere in their coding sequence, or that changes in the expression levels of these {alpha}-subunits are associated with pituitary tumor formation. Another possibility is that dysregulation of components downstream from G{alpha}q contribute to tumorigenesis. Inappropriate activation of other G proteins that might be coupled to pituitary cell signaling pathways, including those that control membrane Ca2+ conductance and MAP kinase activity, remain to be explored. Mutations that lead to abnormal activity of different stimulatory hormone or growth factor pathways also need to be considered. It is also possible that pituitary tumor development is related to the loss of one or more inhibitory inputs.

In conclusion, the recombinant mutations known to impair GTPase activity in the G{alpha}q genes occur infrequently, if at all, in human pituitary tumors. Alternative mechanisms, underlying pituitary tumorigenesis , need to be explored.


   Acknowledgments
 
We gratefully acknowledge the cooperation of the Division of Endocrinology, at the Emory Clinic, for their assistance with the management of these patients; and the Department of Neuropathology, at the Emory University Hospital, for the histology and immunohistochemistry (IHC). We also wish to thank the National Hormone and Pituitary Program, Rockville, Maryland, for providing the normal human pituitary tissue.

Received June 9, 1997.

Revised August 21, 1997.

Accepted August 26, 1997.


   References
Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Strathmann M, Simon MI. 1990 G protein diversity: a distinct class of alpha subunits is present in vertebrates and invertebrates. Proc Natl Acad Sci USA. 87:9113–9117.[Abstract/Free Full Text]
  2. Aragay AM, Katz A, Simon MI. 1992 The G alpha q and G alpha 11 proteins couple the thyrotropin-releasing hormone receptor to phospholipase C in GH3 rat pituitary cells. J Biol Chem. 267:24983–24988.[Abstract/Free Full Text]
  3. Hsieh KP, Martin TF. 1992 Thyrotropin-releasing hormone and gonadotropin-releasing hormone receptors activate phospholipase C by coupling to the guanosine triphosphate-binding proteins Gq and G11. Mol Endocrinol. 6:1673–1681.[Abstract]
  4. Spada A, Vallar L. 1992 G-protein oncogenes in acromegaly. Horm Res. 38:90–93.[Medline]
  5. Harris PE. 1996 Gs protein mutations and the pathogenesis and function of pituitary tumors. Metab Clin Exp. 45:120–122.
  6. Vallar L. 1996 Oncogenic role of heterotrimeric G proteins. Cancer Surv. 27:325–338.[Medline]
  7. Boothroyd CV, Grimmond SM, Cameron DP, Hayward NK. 1995 G protein mutations in tumours of the pituitary, parathyroid and endocrine pancreas. Biochem Biophys Res Commun. 211:1063–1070.[CrossRef][Medline]
  8. Chabre O. 1994 G-proteins and endocrine tumors. The example of acromegaly. Rev Prat. 44:1177–1183.[Medline]
  9. Clementi E, Malgaretti N, Meldolesi J, Taramelli R. 1990 A new constitutively activating mutation of the Gs protein alpha subunit-gsp oncogene is found in human pituitary tumours. Oncogene. 5:1059–1061.[Medline]
  10. Williamson EA, Ince PG, Harrison D, Kendall-Taylor P, Harris PE. 1995 G-protein mutations in human pituitary adrenocorticotrophic hormone-secreting adenomas. Eur J Clin Invest. 25:128–131.[Medline]
  11. Landis CA, Masters SB, Spada A, Pace AM, Bourne HR, Vallar L. 1989 GTPase inhibiting mutations activate the alpha chain of Gs and stimulate adenylyl cyclase in human pituitary tumours. Nature. 340:692–696.[CrossRef][Medline]
  12. Williamson EA, Daniels M, Foster S, Kelly WF, Kendall-Taylor P, Harris PE. 1994 Gs alpha and Gi2 alpha mutations in clinically non-functioning pituitary tumours. Clin Endocrinol (Oxf). 41:815–820.[Medline]
  13. Wu DQ, Lee CH, Rhee SG, Simon MI. 1992 Activation of phospholipase C by the alpha subunits of the Gq and G11 proteins in transfected Cos-7 cells. J Biol Chem. 267:1811–1817.[Abstract/Free Full Text]
  14. Kalinec G, Nazarali AJ, Hermouet S, Xu N, Gutkind JS. 1992 Mutated alpha subunit of the Gq protein induces malignant transformation in NIH 3T3 cells. Mol Cell Biol. 12:4687–4693.[Abstract/Free Full Text]
  15. Dong Q, Shenker A, Way J, et al. 1995 Molecular cloning of human G alpha q cDNA and chromosomal localization of the G alpha q gene (GNAQ) and a processed pseudogene. Genomics. 30:470–475.[CrossRef][Medline]
  16. Conklin BR, Chabre O, Wong YH, Federman AD, Bourne HR. 1992 Recombinant Gq alpha. Mutational activation and coupling to receptors and phospholipase C. J Biol Chem. 267:31–34.[Abstract/Free Full Text]
  17. Dong Q, Brucker-Davis F, Weintraub BD, et al. 1996 Screening of candidate oncogenes in human thyrotroph tumors: absence of activating mutations of the G alpha q, G alpha 11, G alpha s, or thyrotropin-releasing hormone receptor genes. J Clin Endocrinol Metab. 81:1134–1140.[Abstract]
  18. Katznelson L, Klibanski A. Endocrine-inactive, FH, LH and {alpha}-subunit adenomas: clinical findings and endocrinology. In: Landolt A, Vance M, Reilly P, eds. Pituitary adenomas. New York: Churchill Livingstone; 127–138.



This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
C.-O. Evans, A. N. Young, M. R. Brown, D. J. Brat, John. S. Parks, A. S. Neish, and N. M. Oyesiku
Novel Patterns of Gene Expression in Pituitary Adenomas Identified by Complementary Deoxyribonucleic Acid Microarrays and Quantitative Reverse Transcription-Polymerase Chain Reaction
J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3097 - 3107.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
P. L. M. Dahia and A. B. Grossman
The Molecular Pathogenesis of Corticotroph Tumors
Endocr. Rev., April 1, 1999; 20(2): 136 - 155.
[Abstract] [Full Text]

Home page
 Endocr. Rev.Home page
S. L. Asa and S. Ezzat
The Cytogenesis and Pathogenesis of Pituitary Adenomas
Endocr. Rev., December 1, 1998; 19(6): 798 - 827.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oyesiku, N. M.
Right arrow Articles by Parks, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oyesiku, N. M.
Right arrow Articles by Parks, J. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals