| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Center for Biotechnology (E.E.) and Department of Medical Nutrition
(M.P-H., K.G., J-
.G.), Novum, S-141 57
Huddinge, Sweden;
Department of Molecular Medicine (S.L., J.L., M.N.), Karolinska
Hospital, CMM, L8:01 and L8:02, S-171 76 Stockholm, Sweden; Department
of Anatomy (M.P-H.), Medical School, University of Tampere and
Department of Pathology (M.P-H.), Tampere University Hospital, Tampere,
Finland; Department of Physiology and Pharmacology (G.F.), Karolinska
Institute and Department of Woman and Child Health (G.F.), Karolinska
Hospital, S-171 77 Stockholm, Sweden
Address correspondence and requests for reprints to: Jan-Åke Gustafsson, Department of Medical Nutrition, Huddinge University Hospital, NOVUM, Huddinge, Sweden S-141 86.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The finding of a second subtype of ER (ERß) has caused considerable excitement amongst endocrinologists. In this article, we present data regarding the genomic structure and chromosomal localization of the human ERß gene, demonstrating that two independent ER genes do exist in the human. Furthermore, we present data regarding the tissue distribution of human ERß, showing that this receptor is expressed in multiple tissues. For instance, ERß is found in developing spermatids of the testis, a finding of potential relevance for the ongoing debate on the effects of environmental estrogens on sperm counts. In addition, we find ERß in ovarian granulosa cells, indicating that estrogens also participate in the regulation of follicular growth in the human.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our unexpected discovery of a second subtype of the estrogen
receptor, ERß, approximately 10 yr after the cloning of ER
(1) has
raised a number of questions regarding the respective physiological
roles of these two receptors (2). Some of the most interesting aspects
of the new estrogen receptor refer to clinically important issues such
as fertility, bone stability, and cardiovascular health.
It has previously been assumed that ER, the first estrogen receptor
to be cloned, was indispensable for maintenance of these functions.
However, studies of ER knock-out (ERKO) mice show that the gene
deletion has little or no effect on bone stability or on the
cardiovascular system (3). One might therefore speculate that ERß has
an important role in these tissues.
In this study we report on the tissue distribution of human ERß and present several examples of tissues where ERß might be of importance.
Characterization of the organization of a gene can give important clues
to the evolutionary relationships within a gene family. Knowledge of
the structure of the human ERß gene is also important for the
characterization of human ERß in hereditary disorders,
e.g. the hereditary forms of prostate cancer and
Alzheimer’s disease. We have therefore begun to characterize the
genomic organization of the ERß gene in mouse and human.
Interestingly, the ERß gene appears to be considerably shorter than
the ER gene. The possible functional implication of this difference
between the ER and ERß genes is discussed.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Fragments from the N-terminal and hinge domain of rat ERß were used to screen human cDNA libraries from ovary and testis (Clontech, Palo Alto, CA). Several partial cDNA clones were obtained, which were then joined by PCR and restriction enzyme digestion. The first 45 and the last 59 amino acids were obtained by PCR on human ovary cDNA, using primers derived from the rat ERß cDNA sequence. The obtained sequence was essentially identical to a partial human ERß sequence published recently (9).
Exon/intron structure
Pairs of PCR primers corresponding to fragments in the N-terminal and ligand-binding domains were designed and used to identify a mouse P1 clone containing the translated exons of ERß (Genome Systems Inc., St. Louis, MO). The parts containing exons were subcloned, and the distance between the exons was determined by subcloning of the respective intron or by PCR.
The human exon/intron structure was determined by PCR on total human genomic DNA, using primers in the respective exons, as inferred by the mouse genomic structure. The respective PCR products were subcloned, and the sequence of the respective ends determined by cycle sequencing.
PCR mapping
The cell lines used to determine the chromosomal localization of the ERß gene by PCR were human-rodent somatic hybrids (NIGMS Coriell Cell Repositories, Camden, NJ). Each cell line retains one of the human chromosomes in addition to the rodent genome. PCR screening was performed with oligonucleotides designed from the ligand-binding domain of human ERß cDNA.
Fluorescence in situ hybridization
Chromosome slides were prepared from lymphocyte cultures as previously described (4). A centromere-specific hybridization was included using a probe specific for the chromosome 14 and 22 centromeres. A human ERß P1 clone was obtained from a reference library database, library no. 700 (P1 human), Max-Planck Institut für Molekular Genetik, Berlin, Germany. This clone was labeled with biotin-12-dUTP (Gibco BRL, Gaithersburg, MD), and the centromere-specific probe was labeled with fluoro-red-dUTP (Amersham International, Amersham, Buckingshamshire, UK) by nick translation.
The P1-DNA probe was preannealed with 3 µg human Cot-1 DNA (Gibco BRL) for 60 min at 37 C and hybridized together with the centromere 14/22 specific probe to human metaphase chromosomes. The slides were pretreated and hybridized as previously described (4). In total, 30 metaphases were analyzed, and the hybridization signals were seen in the metaphase chromosomes as two symmetrical dots on 14q22–24.
Digital image microscopy
The signals were visualized using a Zeiss Axiophot fluorescence microscope equipped with a cooled CCD-camera (Photometrics Nu 200/CH 250, Tuscon, AZ) for image capturing. The results were analyzed on a Macintosh Quadra 950 computer (Macintosh, Cuppertino, CA) using the SmartCapture software (Digital Scientific, Cambridge).
Northern blot analysis
The Multiple Tissue Northern blots are products of Clontech. The Northern blot contains messenger RNA (mRNA) from spleen, thymus, prostate, ovary, testis, small intestine, colon, and peripheral blood leukocytes (PBL). The filters were hybridized as recommended by the supplier, using either a probe corresponding to 300 bp in the N-terminal domain or a probe corresponding to 200 bp in the hinge domain of the human ERß cDNA.
Preparation of isolated granulosa cells
Luteinized granulosa cells were obtained (with informed consent from the patients) from follicular fluid obtained at ovum-pick-up for in vitro fertilization. Follicular fluid was layered on a gradient of Ficoll-Paque (Pharmacia, Uppsala, Sweden) and centrifuged at 800 g for 30 mins. Granulosa cells were removed from the gradient interface and resuspended in culture medium [serum-free hybridoma medium (Sigma, Stockholm, Sweden) + 4% fetal calf serum (Gibco, Stockholm, Sweden)] and plated in 8 cm dishes. Cells were cultured for 3–5 days, after which cells were lysed and isolated for RNA.
RT-PCR analysis
The primer pair used for ER was AATTCAGATAATCGACGCCAG and
GTGTTTCAACATTCTCCCTCCTC, corresponding to nucleotides 457–477 and
801–779 of the human ER open reading frame. The primer pair used
for ERß was TAGTGGTCCATCGCCAGTTAT and GGGAGCCACACTTCACCAT,
corresponding to nucleotides 125–145 and 517–499 of the human ERß
ORF. The RT-PCR was performed essentially as described previously (5).
cDNA-synthesis was done with 1 µg of total RNA, using Superscript RT
(Life Technologies, Stockholm, Sweden). One twelth of the cCNA
synthesis was used in PCR, using Taq-polymerase (Pharmacia).
The PCR was carried out in a 9600 Thermocycler (Perkin Elmer, Foster
City, CA) using the following program: 95 C 30 sec, 33 x (95 C 30 sec,
56 C 15 sec, 72 C 60 sec), 72 C 3 min. The PCR products were separated
on a 2% Nusieve agarose gel (FMC, Rockland, ME) and blotted onto a
HybondN + membrane (Amersham), according to the manufacturer’s
recommendations. The filter was then probed with internal
oligonucleotide probes specific for ER (CCAATGACAAGGGAAGTATGG),
ERß (GTTCCCACTAACCTTCCTTTTCA), or actin (GATGACCCAGATCATGTTTGA).
RNAse protection assay (RPA)
The vectors used for generation of RPA probes were:
pBS-hER(1016–1268), the insert corresponding to nucleotides
1016–1268 of the human hER ORF; pBS-hERß P/E-T7, the insert
corresponding to nucleotides 792–978 of the human ERß ORF; and
TKS-ActP/Act3-T7, the insert corresponding to nucleotides 374–492 of
the human ß-actin cDNA ORF.
The RNAse protection assay was performed essentially as described
previously (6). The gels were exposed on film as well as analyzed using
a Fujix bioimager (Fuji, Tokyo, Japan). Calculation of mRNA levels was
based on the parallell quantification of known amounts of in
vitro transcribed ER and ERß mRNA, respectively.
Total RNA was prepared as described previously (7). After the RNA had been dissolved, the concentration was determined spectrophotometrically, and the intregrity of the RNA was verified by agarose gel electophoresis.
In situ hybridization
Four oligonucleotides derived from human ERß cDNA (nucleotides 542–589, 1089–1136, 1326–1373, and 1384–1431) were labeled to a specific activity of 1 x 109 cpm/mg at the 3'-end with 33P-dATP (NEN, Boston, MA), using terminal deoxynucleotidyltransferase (Amersham). All probes produced similar results. Several control probes of the same length, with similar GC-content and specific activity, were used to ascertain the specificity of the hybridizations. Addition of 100 mol/L excess of the unlabeled probe abolished all hybridization signals.
Human tissues for in situ hybridization were obtained after surgery performed for different reasons. Unless mentioned, normal tissues were used.
The tissues were frozen and sectioned in Microm HM 500 cryostat at 14 µm and thawed onto Probe-On glass slides (Fisher Scientific, Philadelphia, PA). The sections were stored at 20 C until used. In situ hybridization was carried out as previously described (8). The slides were incubated in humidified boxes at 42 C for 18 h with 5 ng/mL of the labeled probe in the hybridization mixture, washed, dried, and covered with Amersham ß-max autoradiography film (Amersham) for 30–60 days. Alternatively, the sections were dipped in Kodak NTB2 nuclear track emulsion (Rochester, NY) and exposed for 90 days at 4 C. The sections were examined in a Nikon Microphot-FX microscope (Alexandria, VA) equipped for dark-field and epipolarization microscopy. T-Max 100 black-and-white film (Kodak) was used for photography. Finally, the sections were stained with cresyl violet and analyzed under brightfield conditions.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, in its translated portion (Table 1
).
|
), thus determining the
exon/intron organization.
|
We have mapped the chromosomal localization of human ERß. Using PCR
technique, we show that the human ERß gene is localized on chromosome
14 (Fig. 1, A), and using the FISH technique we have mapped ERß to
14q22–24 (Fig. 1, B). To broadly characterize the tissue distribution
of human ERß, we have employed a "spot blot" technique to detect
the presence of ERß RNA in several human tissues. Using this
technique, the highest ERß expression was found in kidney, thymus,
and small intestine. High expression was also seen in lung, spleen,
pituitary gland, blood leukocytes, bone marrow, colon, and uterus (not
shown).
|
).
|
). The major
transcript is approximately 7 kb, but at least one weak band of higher
molecular weight, around 9.5 kb, can also be seen, suggesting multiple
transcriptional start sites and/or polyadenylation sites.
|
, a and b), whereas
the muscle layer is devoid of labeling. In kidney, the expression seems
to be strongest in the cortex (Fig. 4c), and in dipped sections a
strong signal is evident in convoluted tubules in cortex (Fig. 4d).
Also the transitional epithelium in renal pelvis expresses ERß (Fig. 4c). In lung a signal is detected both in the lung parenchyma and in
the blood vessels (Fig. 4f). In breast, the epithelium of the tubules
expresses detectable levels of ERß, and in some breast cancers we
have detected ERß (Fig. 4g). In the ovary, the signal is localized to
the stroma of the cortex and in blood vessels of the medulla (Fig. 4h)
as well as to the granulosa cells (not shown). In lymph nodes a large
portion of the lymphocytes express ERß (Fig. 4i). We can also detect
ERß signals with in situ hybridization in the uterus and
the adrenal cortex (not shown), thus largely confirming the spot blot
data. In prostate low signal is seen in the epithelium of secretory
alveoli while the stroma is nonlabeled (Fig. 4j). In testis, ERß is
localized in the seminiferous epithelium, whereas the interstitial
Leydig cells are nonlabelled (Fig. 4k). In dipped sections, grains
demonstrating ERß mRNA can be seen over developing spermatids,
particularly primary spermatocytes and early round spermatids, whereas
Sertoli cells and germ cells at earlier stages of differentiation are
negative (Fig. 4l).
|
and ERß in a few of the cell
types mentioned above, we performed RNAse protection assays. These
assays show the highest expression of ERß mRNA in ovary and isolated
granulosa cells, mammary gland and lung, whereas the ER signal was
strongest in endometrium, ovary, and in one of the breast tumor samples
(Fig. 5, a and b). Calculation of the
ratio between the ER and ERß mRNA levels shows that, in isolated
granulosa cells and in cells from human umbilical vein endothelium
(HUVEC), only ERß is expressed. The analyzed prostate tumor sample
clearly demonstrated higher levels of ERß mRNA than ER mRNA,
although the total levels of both transcripts were low. In mammary
gland, the two breast tumor samples analyzed, the endometrium and the
endometrial carcinoma cell line Ishikawa, the amount of ER mRNA was
higher than ERß mRNA. Finally, in lung and in ovary, the amounts of
ER and ERß mRNA were approximately equal (Fig. 5 c). It
should be noted, however, that in HUVEC cells and in lung, the levels
of both receptor messages are low.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene has shown that it is a very
large gene, with the translated exons spanning more than 140 kb (10).
The ER genes from fish, however, are considerably smaller spanning
approximately 30–40 kb (11, 12). Our data show that the size of the
ERß gene is similar to those of the fish ERs (Fig 6
, C). It has been speculated that the
size of the introns might influence the transcriptional efficiency of a
gene, particularly in situations of rapid cell division (13). The
relevance of this phenomenon for mammalian genes has never been
verified. For other paralogous genes in the nuclear receptor
superfamily, the gene size has been shown to vary at least to the same
extent as for the ER subtypes. The PPAR genes, for example, differ in
size from 30–105 kb in the mouse (14).
All exon/intron boundaries are well conserved in the ERß gene as
compared with the human ER gene. Notably, the only difference
observed in the genomic organization of the ER genes is the intron
present in the middle of the D domain of the ER isolated from rainbow
trout (11) and O. aureus, which is absent from both ER
and ERß (Fig. 7b). Interestingly, sequence comparison of all known
estrogen receptors shows that these receptors seem to form three
groups, where the receptors cloned from fish constitute a separate
subgroup. The exception in the fish subgroup is the ER cloned from
Japanese eel (15), which actually represents an ERß homologue. The
question whether this third subgroup represents an "ER
" is
obviously interesting. However, extensive PCR studies employing primers
designed on the basis of the "fish ER" have hitherto failed to show
the existence of a mammalian ER (E. Enmark, unpublished
observations).
Using the FISH technique, we have mapped ERß to 14q22–24. Since the
human ER gene has been mapped to the long arm of chromosome 6, this
definitely excludes the possibility of differential splicing to explain
the formation of the ERß isoform. 14q22–24 represents a region
homologous to mouse chromosome 12, to which the mouse ERß has
recently been mapped using interspecific backcross analysis (16).
Furthermore, 14q22–24 is close to a recently identified gene
associated with early onset of Alzheimer’s disease (17). It has been
claimed that estrogen replacement therapy reduces the risk of
Alzheimer’s disease in women, or improves this condition in some
patients (18). Furthermore, this region of chromosome 14 is frequently
involved in rearrangements in human uterine leiomyoma (19) and
neoplasms of the kidney (20). A more detailed mapping of this
chromosomal region, as well as studies on patient material, will in
time tell whether this chromosomal localization of ERß has any
relevance to the diseases mentioned.
The human ER has been shown to have at least three separate
promoters with different but overlapping tissue distribution (5, 21).
The mouse ERß was recently shown to give at least four bands on
Northern blots (16), possibly indicating that the ERß gene is also
characterized by multiple promoters. Interestingly, we and others (9)
have observed multiple transcript sizes for human ERß.
Furthermore, in the O.aureus ER, two alternative polyadenylation sites located approximately 300 bp apart have been found, in addition to two different transcription start sites (12).
Estrogens have important functions both in the reproductive system and in other tissues such as bone and the cardiovascular system. We have recently reported that the expression of ERß in the rat is highest in ovary and prostate, with lower but significant expression also in other tissues (1). The most striking difference between human and rodent is seen in the prostate, where the expression of ERß is very high in the rat, but is relatively low in the human, as judged from Northern blot and in situ hybridization. In ovaries, the stroma of the cortex expresses ERß in the human but not in the rat. Finally, the high levels of ERß seen in the gastrointestinal tract of the human contrast to much lower levels in the rat.
Using cultured human granulosa cells we show that, just as reported in the rat (1), the granulosa cells in humans contain only ERß mRNA. Thus, it can be concluded that ERß is likely to play an important role in the regulation of follicular growth and oocyte development.
In the testis, ER has previously been reported to be expressed in
the Leydig cells of the testis, where no ERß signal was detected
(22). In contrast, we find ERß expressed in the developing
spermatids, where ER is absent.
During recent years, there has been an intensive debate concerning
alleged effects of different xenobiotics on the reproductive ability of
animals, particularly in fish and man (reviewed in 23). A class of
compounds called "environmental estrogens", including
polychlorinate biphenals, has been the particular focus. We have shown
that both ER and ERß may bind at least some of these compounds
(24). Although the affinity is relatively low, ERß binds two
xenoestrogens, methoxychlor and bisphenol A, with considerably higher
affinity than ER. In this paper we show that human ERß is
expressed in the developing spermatocytes of the testis. It is tempting
to speculate that some of the claimed effects of environmental
estrogens on fertility might be mediated via ERß.
We show here that both ER and ERß are expressed in human breast.
In breast tumors the expression of the two receptors seems to vary. In
future characterization of tumors from breast it might thus be relevant
to determine the expression of both estrogen receptors.
It has long been known that estrogens have important effects on the immune system. One of many examples refers to pregnancy, where the immune system is significantly downregulated, leading to decreased size of both spleen and thymus. Most autoimmune diseases are also more common in women than in men (25). Many of the tissues in which we find high expression of human ERß are related to the immune system. An exciting possibility is that some of the immunomodulatory effects of estrogen might be mediated via ERß. Interestingly, the ERß-containing pituitary is a common modulator of both the immune system and the endocrine system (26).
Recently, it was shown that in ERKO mice, where the ER gene had been
disrupted, the atheroprotective effect of estrogen was unchanged, using
a carotid arterial injury model. The authors concluded that the
protective effect was independent of ER (27). In this study, we
report that in humans, ERß but not ER is expressed in the
umbilical vein endothelial cells, a finding well in line with these
observations in mice. This finding may be of potential relevance for
understanding the atheroprotective effects of estrogen.
We have previously shown that ERß has a relatively high affinity for
several plant-derived substances with estrogenic activity, considerably
higher than that exhibited by ER (24). It is possible that the human
ERß expressed in the gastrointestinal tract is exposed to these
compounds via the diet. For several years it has been claimed that
estrogens may protect against colon cancer (28). Similar claims have
also been made for diets containing soy protein, a product rich in
phytoestrogens (29). Estrogens have furthermore been shown to affect
calcium uptake in the intestine through a poorly understood mechanism
(30). Perhaps ERß may mediate some of these effects.
In conclusion, we show in this report that human ERß is highly expressed in many human organs, including some traditionally and probably erroneously considered "nontarget tissues" for estrogen.
The findings of high expression of ERß in ovary, granulosa cells, and
endometrium clearly indicate that many of the effects of estrogen on
human female reproductive function may be mediated by this receptor.
This is critically important, as the reports of absence of ER from
primate (monkey, human) granulosa cells (31, 32) have lead to an
alternative model for the regulation of the human menstrual cycle. This
model postulates that in primates, growth factors (activin, inhibin,
and IGFs) take the role of estrogen in the rodent ovary (33). Our
results indicate that estrogen may be as important for human ovarian
function and reproduction as in the rodent.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received August 11, 1997.
Revised September 17, 1997.
Accepted September 19, 1997.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ß. Endocrinology. 138:863–870.-deficient mice. Nature Med. 3:545–548.
This article has been cited by other articles:
 |
|
 |
|
  N. B. Janakiram, V. E. Steele, and C. V. Rao Estrogen Receptor-{beta} as a Potential Target for Colon Cancer Prevention: Chemoprevention of Azoxymethane-Induced Colon Carcinogenesis by Raloxifene in F344 Rats Cancer Prevention Research, January 1, 2009; 2(1): 52 - 59. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Sotoca Covaleda, H. van den Berg, J. Vervoort, P. van der Saag, A. Strom, J.-A. Gustafsson, I. Rietjens, and A. J. Murk Influence of Cellular ER{alpha}/ER{beta} Ratio on the ER{alpha}-Agonist Induced Proliferation of Human T47D Breast Cancer Cells Toxicol. Sci., October 1, 2008; 105(2): 303 - 311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Shaaban, A. R. Green, S. Karthik, Y. Alizadeh, T. A. Hughes, L. Harkins, I. O. Ellis, J. F. Robertson, E. C. Paish, P. T.K. Saunders, et al. Nuclear and Cytoplasmic Expression of ER{beta}1, ER{beta}2, and ER{beta}5 Identifies Distinct Prognostic Outcome for Breast Cancer Patients Clin. Cancer Res., August 15, 2008; 14(16): 5228 - 5235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Niikawa, T. Suzuki, Y. Miki, S. Suzuki, S. Nagasaki, J. Akahira, S. Honma, D. B. Evans, S.-i. Hayashi, T. Kondo, et al. Intratumoral Estrogens and Estrogen Receptors in Human Non-Small Cell Lung Carcinoma Clin. Cancer Res., July 15, 2008; 14(14): 4417 - 4426. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Wahlgren, K. Svechnikov, M.-L. Strand, K. Jahnukainen, M. Parvinen, J.-A. Gustafsson, and O. Soder Estrogen Receptor {beta} Selective Ligand 5{alpha}-Androstane-3{beta}, 17{beta}-Diol Stimulates Spermatogonial Deoxyribonucleic Acid Synthesis in Rat Seminiferous Epithelium in Vitro Endocrinology, June 1, 2008; 149(6): 2917 - 2922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ban, F. Sata, N. Kurahashi, S. Kasai, K. Moriya, H. Kakizaki, K. Nonomura, and R. Kishi Genetic polymorphisms of ESR1 and ESR2 that may influence estrogen activity and the risk of hypospadias Hum. Reprod., June 1, 2008; 23(6): 1466 - 1471. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Greenberg, S. Somme, H. E. Russnes, A. D. Durbin, and D. Malkin The Estrogen Receptor Pathway in Rhabdomyosarcoma: A Role for Estrogen Receptor-{beta} in Proliferation and Response to the Antiestrogen 4'OH-Tamoxifen Cancer Res., May 1, 2008; 68(9): 3476 - 3485. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Morandi Alessio, L. H. Siqueira, E. C. Couto de Carvalho, R. Barini, A. de Padua Mansur, N. Fenalti Hoehr, and J. M. Annichino-Bizzacchi Estrogen Receptor Alpha and Beta Gene Polymorphisms Are Not Risk Factors for Recurrent Miscarriage in a Brazilian Population Clinical and Applied Thrombosis/Hemostasis, April 1, 2008; 14(2): 180 - 185. [Abstract] [PDF]
|
|
|
|
 |
|
 J. Teng, Z.-Y. Wang, D. F Jarrard, and D. E Bjorling Roles of estrogen receptor {alpha} and {beta} in modulating urothelial cell proliferation Endocr. Relat. Cancer, March 1, 2008; 15(1): 351 - 364. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Leigh Pearce, A. M. Near, J. L. Butler, D. Van Den Berg, P. Bretsky, D. V. Conti, D. O. Stram, M. C. Pike, J. N. Hirschhorn, and A. H. Wu Comprehensive Evaluation of ESR2 Variation and Ovarian Cancer Risk Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 393 - 396. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Borgquist, C Holm, M Stendahl, L Anagnostaki, G Landberg, and K Jirstrom Oestrogen receptors {alpha} and show different associations to clinicopathological parameters and their co-expression might predict a better response to endocrine treatment in breast cancer J. Clin. Pathol., February 1, 2008; 61(2): 197 - 203. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Damdimopoulos, G. Spyrou, and J.-A. Gustafsson Ligands Differentially Modify the Nuclear Mobility of Estrogen Receptors {alpha} and Endocrinology, January 1, 2008; 149(1): 339 - 345. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. G. Schwartz, A. S. Wenzlaff, G. M. Prysak, V. Murphy, M. L. Cote, S. C. Brooks, D. F. Skafar, and F. Lonardo Reproductive Factors, Hormone Use, Estrogen Receptor Expression and Risk of Non Small-Cell Lung Cancer in Women J. Clin. Oncol., December 20, 2007; 25(36): 5785 - 5792. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Sun, Z. Nawaz, and J. M. Slingerland Long-Range Activation of GREB1 by Estrogen Receptor via Three Distal Consensus Estrogen-Responsive Elements in Breast Cancer Cells Mol. Endocrinol., November 1, 2007; 21(11): 2651 - 2662. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Varricchio, A. Migliaccio, G. Castoria, H. Yamaguchi, A. de Falco, M. Di Domenico, P. Giovannelli, W. Farrar, E. Appella, and F. Auricchio Inhibition of Estradiol Receptor/Src Association and Cell Growth by an Estradiol Receptor {alpha} Tyrosine-Phosphorylated Peptide Mol. Cancer Res., November 1, 2007; 5(11): 1213 - 1221. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Savolainen, T. Pakarainen, I. Huhtaniemi, M. Poutanen, and S. Makela Delay of Postnatal Maturation Sensitizes the Mouse Prostate to Testosterone-Induced Pronounced Hyperplasia: Protective Role of Estrogen Receptor-{beta} Am. J. Pathol., September 1, 2007; 171(3): 1013 - 1022. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.M. Corbo, L. Ulizzi, L. Piombo, C. Martinez-Labarga, G.F. De Stefano, and R. Scacchi Estrogen receptor alpha polymorphisms and fertility in populations with different reproductive patterns Mol. Hum. Reprod., August 1, 2007; 13(8): 537 - 540. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Stygar, B. Masironi, H. Eriksson, and L. Sahlin Studies on estrogen receptor (ER) {alpha} and {beta} responses on gene regulation in peripheral blood leukocytes in vivo using selective ER agonists J. Endocrinol., July 1, 2007; 194(1): 101 - 119. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Heldring, A. Pike, S. Andersson, J. Matthews, G. Cheng, J. Hartman, M. Tujague, A. Strom, E. Treuter, M. Warner, et al. Estrogen Receptors: How Do They Signal and What Are Their Targets Physiol Rev, July 1, 2007; 87(3): 905 - 931. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G.-E. Costin and V. J. Hearing Human skin pigmentation: melanocytes modulate skin color in response to stress FASEB J, April 1, 2007; 21(4): 976 - 994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Ohnemus, M. Uenalan, J. Inzunza, J.-A. Gustafsson, and R. Paus The Hair Follicle as an Estrogen Target and Source Endocr. Rev., October 1, 2006; 27(6): 677 - 706. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. T. Zhu, G.-Z. Han, J.-Y. Shim, Y. Wen, and X.-R. Jiang Quantitative Structure-Activity Relationship of Various Endogenous Estrogen Metabolites for Human Estrogen Receptor {alpha} and {beta} Subtypes: Insights into the Structural Determinants Favoring a Differential Subtype Binding Endocrinology, September 1, 2006; 147(9): 4132 - 4150. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Takase, M.-H. Levesque, V. Luu-The, M. El-Alfy, F. Labrie, and G. Pelletier Expression of Enzymes Involved in Estrogen Metabolism in Human Prostate J. Histochem. Cytochem., August 1, 2006; 54(8): 911 - 921. [Abstract] [Full Text] [PDF]
|
|
