help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skinner, M. M.
Right arrow Articles by Thorner, M. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skinner, M. M.
Right arrow Articles by Thorner, M. O.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 12 4314-4320
Copyright © 1998 by The Endocrine Society


Original Studies

Growth Hormone Secretagogue Receptor Expression in Human Pituitary Tumors1

Monica M. Skinner, Ralf Nass, Beatriz Lopes, Edward R. Laws and Michael O. Thorner

Division of Endocrinology and Metabolism, Department of Medicine (M.M.S., R.N., M.O.T.), Department of Pathology (B.L.), and Department of Neurosurgery (E.R.L.), University of Virginia Health Sciences Center, Charlottesville, Virginia 22908

Address all correspondence and requests for reprints to: Dr. Michael O. Thorner, Department of Medicine, University of Virginia Health Sciences, Box 466, Charlottesville, Virginia 22908. E-mail: mot{at}virginia.edu


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The GH secretagogue (GHS) receptor (GHS-R) has been characterized and cloned. It is a member of a family of seven transmembrane receptors and is closely related to the neurotensin and TRH receptors. To determine the expression of this receptor in normal anterior pituitary and in 24 human pituitary adenomas, we analyzed GHS-R messenger ribonucleic acid (mRNA) using a RT-PCR assay. We found that normal human pituitary was positive for the GHS-R signal. In addition, all GH-secreting adenomas and the one TSH-secreting adenoma demonstrated the presence of GHS-R mRNA. Three of four ACTH-secreting tumors and three of nine gonadotroph adenomas were also positive for the GHS-R mRNA. To determine the amounts of GHS-R mRNA in normal pituitary and in representative tumors, semiquantitative competitive PCR was performed. We determined that normal pituitary had approximately 750 molecules/L GHS-R mRNA. The acromegalic tumor had approximately 1.5 x 105 molecules/L, and the TSH-secreting tumor had approximately 7.5 x 103 molecules/L. Other tumor types contained considerably less, with the ACTH-secreting and gonadotroph tumors expressing 7.5 x 102 and 3 x 102 GHS-R mRNA molecules/L, respectively. These results suggest that GH- and TSH-producing adenomas express GHS-R mRNA at levels 200 and 10 times higher, respectively, than the normal pituitary, and that this receptor expression may be involved in the pathogenesis and growth of these pituitary adenomas.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
THE BIOSYNTHESIS and secretion of GH in the anterior pituitary gland is under complex hormonal regulation. It is regulated by two hypothalamic hormones, somatostatin and GHRH, which oppose one another and act through distinct membrane receptors. Somatostatin inhibits GH release via a family of GTP-binding protein-coupled membrane receptors (1, 2, 3), and GHRH activates GH release through a stimulatory G protein-coupled receptor (4). GH regulates its own release through negative feedback loops acting at the level of the hypothalamus via GH receptors in arcuate neurons and the periventricular nucleus (5, 6).

In addition, a class of synthetic molecules, termed GH secretagogues (GHSs), act at both the pituitary and the hypothalamus to stimulate and amplify pulsatile GH release. GHSs induce the release of GHRH from arcuate neurons and act to functionally antagonize somatostatin (7, 8, 9, 10, 11, 12). The synthetic hexapeptide GHRP-6 contains D-amino acids and stimulates GH release by a pathway distinct from that of GHRH (13, 14). The nonpeptide mimetics of GHRP-6, L-692,429 and MK-0677, have improved pharmacokinetics and oral bioavailability (15). GHSs cause depolarization and inhibition of potassium channels, induce a transient increase in the concentration of intracellular calcium in somatotrophs, increase intracellular concentrations of inositol triphosphate, and increase the activity of protein kinase C (16, 17, 18, 19, 20).

Recently, a receptor was cloned and was shown to be the target of GHSs (21). Sequence analysis of the GHS receptor (GHS-R) reveals that it has seven transmembrane domains and shares only limited sequence homology with other known G protein-coupled receptors. An initial mapping study of GHS-R in human tissue revealed its expression in pituitary, hypothalamus, and hippocampus as well as a weak signal in pancreas (22). GHS-R is also expressed in human fetal pituitary tissue (23). Recently, Bennett et al. (24) showed that hypothalamic GHS-R expression was highly sensitive to GH, being markedly increased in GH-deficient dw/dw dwarf rats and decreased in dw/dw rats treated with bovine GH, suggesting that GHS-R may be involved in feedback regulation of GH.

Characterization of the GHS receptor provides evidence for the presence of an endocrine pathway distinct from that described for GHRH and somatostatin that contributes to the control of GH release. Thus, it is important to determine its expression in different pituitary cell types. X-Linked inactivation studies have demonstrated that the vast majority of pituitary tumors are monoclonal and are comprised solely of one cell type (25, 26, 27, 28), thus offering a unique opportunity to determine cell type-specific expression of GHS-R as well as to study its possible effect on tumor proliferation. It is unknown which, if any, factor selectively stimulates the clonal proliferation of pituitary tumor cells. Alterations in hormone biosynthesis and secretion as well as abnormal cell surface receptor gene expression by pituitary adenomas may provide clues to the underlying cellular mechanisms that modulate pituitary cell proliferation.

Therefore, we used a semiquantitative approach to determine the amount of GHS-R messenger ribonucleic acid (mRNA) in different pituitary tumor cell types and in nonadenomatous postmortem pituitary. As the ligands for the GHS-R behave as amplifiers of GHRH activity and functional antagonists of somatostatin, the expression of GHRH receptor (GHRH-R) and the somatostatin receptor (SSTR2) was comparatively analyzed by RT-PCR in these same tumors.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Patients

Pituitary tumors were collected from 24 patients at the time of transsphenoidal resection and were snap-frozen at -70 C until the time of RNA preparation. These tumors were classified according to their immunohistochemical staining for ACTH, GH, PRL, FSH, LH, and TSH. Ten patients had tumors positive for GH (AT-1 to AT-10), nine patients had tumors positive for FSH or LH (NT-1 to NT-9), four patients had tumors positive for ACTH (CT-1 through CT-4), and one patient had a TSH-positive tumor (TT-1). The clinical and pathological characteristics of the patients and the tumors are summarized in Tables 1Go and 2Go. Normal human postmortem pituitary tissue was obtained frozen from the National Hormone Pituitary Program.


View this table:
[in this window]
[in a new window]
 
Table 1. Immunospecific staining of surgically excised pituitary macroadenomas

 

View this table:
[in this window]
[in a new window]
 
Table 2. Serum hormone data of patients with pituitary adenomas

 
RNA preparation

Total RNA was extracted from the GH- and TSH-secreting tumors and normal pituitary tissue using the product TriReagent (Molecular Research Center, Inc., Cincinnati, OH). Polyadenylated [poly(A)+] RNA was extracted from the nine gonadotroph adenomas and the four ACTH-secreting tumors using the QuickPrep Micro mRNA purification kit from Pharmacia Biotech (Piscataway, NJ). Quantitation of the RNA was performed by spectrophotometry using an optical density of 260 nm. The integrity of the RNA samples was tested using PCR with primers for the human glyceraldehyde 3-phosphate dehydrogenase gene (Stratagene, La Jolla, CA). Each sample produced the expected 600-bp fragment when analyzed by agarose gel electrophoresis (data not shown).

RT-PCR analysis of GHRH-R, GHS-R, and SSTR2 mRNA

For each RT reaction, either 1.25 g total RNA or 62.5 ng poly(A)+ RNA from each specimen were heated to 65 C for 5 min and then cooled on ice. The RNA was then incubated with 0.625 g oligo(deoxythymidine)15 primer (Promega Corp., Madison, WI), 2.5 L 10 mmol/L of each of the four deoxy (d)-NTPs (Promega Corp.), 5 L 100 mmol/L dithiothreitol, 10 L 5 x reaction buffer (375 mmol/L KCl, 250 mmol/L Tris-HCl, and 15 mmol/L MgCl2), and 500 U Moloney murine leukemia virus (MMuLV) reverse transcriptase (Life Technologies, Gaithersburg, MD; total reaction volume, 50 L). RT reactions were carried out at 25 C for 10 min [oligo(deoxythymidine) annealing], followed by a 60-min elongation step at 37 C and MMuLV-RT heat inactivation at 99 C for 5 min.

PCR oligonucleotide primer sets for GHRH-R, GHS-R, and SSTR2 were designed to amplify 350-, 429-, and 892-bp products, respectively. The following GHRH-R primers were used (5'-3'): MS7 TCTGAGCCCTTTCCACCTTACCCTGTG and MS8 GCTGAAGTTGGTCATGGTGGCGAAATG. Oligonucleotide primers for human GHS-R were (5'-3') MS11 CTCTGCATGCCCCTGGACCTCGTTCGC and MS12 CTGCCGATGAGACTGTAGAGGACCGTGAGAC. Oligonucleotide primers for human SSTR2 were (5'-3') MS15 GATGATCACCATGGCTGTG and MS16 CAGGCATGATCCCTCTTC. All amplifications were carried out by the following method. Ten liters of each reverse transcribed product were incubated at 95 C for 5 min with 20 pmol each of specific 5'- and 3'-oligonucleotide primers, water, and a wax bead (Perkin Elmer, Branchburg, NJ; total reaction volume, 40 L). After cooling to room temperature for 10 min, 8 L 10 x reaction buffer (100 mmol/L Tris-HCl, 15 mmol/L MgCl2, and 500 mmol/L KCl, pH 8.3), 2 L 10 mmol/L deoxy-NTPs, 2.5 U Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN), and water to a final volume of 80 L were layered on top of the wax barrier. The reactions were carried out in a DNA thermal cycler 480 (Perkin Elmer) for 40 cycles (1 min at 94 C, 1 min at 45 C, and 90 s at 72 C). The PCR products were electrophoresed on 1.0% agarose gel and visualized under UV light. Control reactions without MMuLV reverse transcriptase were also performed to exclude genomic DNA contamination as a source of amplified signal (data not shown).

Quantitation of the GHS-R using MIMIC PCR

A competitive PCR approach using a nonhomologous internal standard called a PCR MIMIC (Clontech, Palo Alto, CA) was used to analyze the level of GHS-R mRNA in normal human pituitary tissue and in human pituitary tumors. A PCR MIMIC consists of a heterologous DNA fragment with primer templates that are recognized by a pair of gene-specific primers. The template mimics the target and is amplified during PCR.

To construct the 559-bp GHS-R PCR MIMIC, two rounds of PCR amplification were performed according to the manufacturer’s protocol (Clontech). In the first PCR reaction, two composite primers were used (5'-3'): MS13 CTCTGCATGCCCCTGGACCTCGTTCGCCGCAAGTGAAATCTCCTCCG and MS14 CTGCCGATGAGACTGTAGAGGACCGTGAGACATTTGATTCTGGACCATGGC. Each composite primer has the GHS-R gene primer sequence attached to a 20-nucleotide stretch of sequences (underlined) designed to hybridize to opposite strands of the MIMIC DNA fragment (574-bp BamHI/EcoRI fragment of v-erbB). A dilution of the first PCR reaction was then amplified again using the GHS-R gene-specific primers MS11 and MS12 (see above). The GHS-R PCR MIMIC was purified using a CHROMA SPIN+TE-100 column (Clontech), and the yield was calculated according to manufacturer’s instructions. A portion of the concentrated PCR MIMIC was diluted to 100 attomol/L (equal to 6 x 107 molecules/L) from which 10-fold serial dilution stock solutions were made. The 10-2-10-7 10-fold serial dilutions (equal to 6 x 105 to 6 x 100 molecules/L, respectively) were used to titrate a constant amount of target complementary DNA (cDNA).

RT reactions were performed using tumor samples that were positive for GHS-R by RT-PCR. The reactions were performed as described above, except that 37.5 ng poly(A)+ or 0.75 g total RNA were used in a scaled reaction with a final volume of 30 L. Two liters of each serial dilution of the GHS-R PCR MIMIC were added to PCR amplification reactions containing constant amounts (2 L) of cDNA from normal pituitary or tumor samples, 5 L 10 x PCR reaction buffer [100 mmol/L Tris-HCl (pH 8.3), 500 mmol/L KCl, and 20 mmol/L MgCl2], 1 L 10 mmol/L dNTPs, 1 L 20 mol/L MS11, 1 L 20 mol/L MS12, 2 U Taq DNA polymerase (Boehringer Mannheim), and water to a final volume of 50 L. Reactions were carried out for 40 cycles (45 s at 94 C, 45 s at 50 C, 90 s at 72 C). The PCR products were electrophoresed on 1.6% agarose gel, stained with ethidium bromide, and visualized under UV light.

A 2-fold serial dilution series was made for each sample after determining which 10-fold MIMIC dilution produced PCR MIMIC and target cDNA template bands of equal intensity. The MIMIC dilution 10-fold less dilute than the dilution that gave bands of equal intensity was used to start the 2-fold serial dilutions. PCR amplification reactions were carried out as described above, except with 2 L of each 2-fold serial dilution of the GHS-R PCR MIMIC added to constant amounts (2 L) of cDNA from normal pituitary or tumor samples. By knowing the amount of GHS-R PCR MIMIC added to the reactions, the amount of GHS-R target template was determined in each sample.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Expression of GHS-R in normal and neoplastic human pituitary tissues

The results of the RT-PCR using primers MS11 and MS12 for the GHS-R are shown in Fig. 1Go. All 10 acromegalic tumors were positive for the 429-bp GHS-R fragment (Fig. 1AGo), as were three of nine gonadotroph adenomas (Fig. 1BGo, lanes 2, 5, and 10), three of four of the ACTH-secreting tumors (Fig. 1CGo, lanes 2, 4, and 5), and the TSH-secreting tumor (Fig. 1DGo). The normal human pituitary sample was also positive for the GHS-R signal (Fig. 1EGo).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. GHS-R expression in pituitary tumors. Total RNA or poly(A)+ RNA extracted from pituitary tumors and normal pituitary tissue was reverse transcribed, and the resulting products were amplified by PCR with specific oligonucleotide primers for GHS-R. The PCR products were electrophoresed on an agarose gel and stained with ethidium bromide, as shown above. A, Acromegalic tumors AT-1 to AT-10 (lanes 2–11) exhibited a RT-PCR product of the anticipated size (429 bp). B, Gonadotroph tumors NT-1, NT-4, and NT-9 were positive for the GHS-R product (lanes 2, 5, and 10, respectively). C, ACTH-secreting tumors CT-1, CT-3, and CT-4 were positive for GHS-R (lanes 2, 4, and 5, respectively). D, TSH-secreting tumor TT-1 produced the 429-bp GHS-R PCR product (lane 2). E, Normal pituitary sample produced the GHS-R product (lane 2). The DNA mol wt markers are, from top to bottom, 517, 396, and 344 bp in lane 1 of all panels.

 
Expression of GHRH-R in normal and neoplastic human pituitary tissues

RT-PCR results for the GHRH-R are shown in Fig. 2Go. Analysis of the GHRH-R mRNAs with primers MS7 and MS8 demonstrated that the expected 350-bp PCR fragment was detectable in all 10 acromegalic tumors (Fig. 2AGo), all 9 gonadotroph adenomas (Fig. 2BGo), all 4 ACTH-secreting tumors (Fig. 2CGo), the TSH-secreting tumor (Fig. 2DGo), and the normal pituitary sample (Fig. 2EGo).



View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. GHRH-R expression in pituitary adenomas. Total RNA or poly(A)+ RNA extracted from pituitary tumors and normal pituitary was reverse transcribed, and the resulting products were amplified by PCR with specific oligonucleotide primers for GHRH-R. The PCR products were electrophoresed on an agarose gel and stained with ethidium bromide, as shown above. A, Acromegalic tumors AT-1 to AT-10 (lanes 2–11) exhibited a RT-PCR product of the anticipated size (350 bp). B, Gonadotroph adenomas NT-1 to NT-9 displayed the expected 350-bp product (lanes 2–10). C, ACTH-secreting tumors CT-1 to CT-4 produced the GHRH-R PCR product (lanes 2–5). D, TSH-secreting tumor TT-1 exhibited the expected 350-bp product (lane 2). E, Normal pituitary produced the 350-bp GHRH-R product (lane 2). The DNA mol wt markers are, from top tobottom, 396, 344, and 298 bp in lane 1 of all panels.

 
Expression of SSTR2 in normal and neoplastic human pituitary tissue

Results from the RT-PCR using primers MS15 and MS16 for SSTR2 are shown in Fig. 3Go. The 10 acromegalic tumor samples were positive for the 892-bp fragment of SSTR2 (Fig. 3AGo). Seven of nine gonadotroph adenomas (Fig. 3BGo, lanes 2, 3, 5–7, 9, and 10), all four ACTH-secreting tumors (Fig. 3CGo), and the TSH-secreting tumor (Fig. 3DGo) were also positive for SSTR2. The normal pituitary sample was positive for the 892-bp fragment (Fig. 3EGo).



View larger version (38K):
[in this window]
[in a new window]
 
Figure 3. SSTR2 expression in pituitary tumors. Total RNA or poly(A)+ RNA extracted from pituitary tumors and normal pituitary was reverse transcribed, and the resulting products were amplified by PCR with specific oligonucleotide primers for SSTR2. The PCR products were electrophoresed on an agarose gel and stained with ethidium bromide, as shown above. A, Acromegalic tumors AT-1 to AT-10 (lanes 2–11) exhibited a RT-PCR product of the anticipated size (892 bp). B, Gonadotroph adenomas NT-1, NT-2, NT-4 to NT-6, NT-8, and NT-9 displayed the SSTR2 PCR product (lanes 2, 3, 5–7, 9, and 10, respectively). C, ACTH-secreting tumors CT-1 through CT-4 produced the expected 892-bp PCR product (lanes 2–5). D, TSH-secreting tumor TT-1 produced the SSTR2 product (lane 2). E, The normal pituitary sample displayed the SSTR2 product (lane 2). The DNA mol wt marker is 1018 bp and is shown in lane 1 in A–E.

 
Quantitation of the GHS-R in normal and neoplastic human pituitary tissues

Results from the GHS-R competitive PCR using 10-fold serial dilutions of the GHS-R MIMIC are shown in Fig. 4Go. Normal pituitary tissue produced MIMIC and target cDNA template bands of equal intensity at 6 x 102 GHS-R molecules/L (Fig. 4AGo, lane 4).



View larger version (53K):
[in this window]
[in a new window]
 
Figure 4. Semiquantitative competitive PCR of GHS-R expression in normal pituitary and pituitary tumors. A portion of the concentrated GHS-R MIMIC was diluted to 100 attomol/L (equal to 6 x 107 molecules/L), from which 10-fold serial dilution stock solutions were made and used to titrate a constant amount of target cDNA. PCR was performed as indicated in Materials and Methods. The GHS-R product is 429 bp, and the GHS-R MIMIC product is 559 bp. A, Competitive PCR using 10-fold serial dilutions of the GHS-R MIMIC sequence added to cDNA from normal pituitary tissue. B, Competitive PCR of 10-fold serial dilutions of the GHS-R MIMIC added to cDNA from the acromegalic tumor AT-4. C, Competitive PCR of 10-fold serial dilutions of the GHS-R MIMIC added to cDNA from the gonadotroph adenoma NT-1. D, Competitive PCR of 10-fold serial dilutions of the GHS-R MIMIC added to cDNA from the ACTH-secreting tumor CT-4. E, Competitive PCR of 10-fold serial dilutions of the GHS-R MIMIC sequence added to cDNA from the TSH-secreting tumor TT-1. Lanes 1–6 represent GHS-R MIMIC dilutions 100-10-5, respectively, in A and E, whereas lanes 2–7 represent GHS-R MIMIC dilutions 100-10-5, respectively, in B–D. The DNA mol wt markers are, from top tobottom, 517, 396, and 344 bp in lane 7 in A and E and in lane 1 of B–D.

 
The acromegalic tumor AT-4 produced MIMIC and target cDNA template bands of equal intensity at 6 x 104 GHS-R molecules/L (Fig. 4BGo, lane 3). The gonadotroph tumor NT-1 had 60 GHS-R molecules/L (Fig. 4CGo, lane 6). The ACTH-secreting tumor CT-4 produced a band that was of equal intensity to 6 x 102 GHS-R MIMIC molecules/L (Fig. 4DGo, lane 5), whereas the TSH-secreting tumor TT-1 had 6 x 103 GHS-R molecules/L (Fig. 4EGo, lane 3).

A 2-fold serial dilution series was made for each sample starting with the MIMIC dilution 10-fold less dilute than the dilution that gave MIMIC and target cDNA bands of equal intensity. After running the PCR samples on an agarose gel, it was determined that 750 MIMIC molecules/L produced a band equal in intensity to the normal pituitary sample (Fig. 5AGo, lane 4).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 5. Two-fold serial dilutions of GHS-R MIMIC in normal pituitary tissue and pituitary adenomas. A, Two-fold serial dilutions were made from the 10-2 10-fold dilution (equal to 6 x 103 molecules/L) of the GHS-R MIMIC and used in competitive PCR with cDNA from the normal pituitary sample. B, Competitive PCR of 2-fold serial dilutions started from the 100 10-fold dilution (equal to 6 x 105 molecules/L) of the GHS-R MIMIC added to constant amounts of cDNA from the acromegalic tumor AT-4. C, Competitive PCR of 2-fold serial dilutions started from the 10-3 10-fold dilution (equal to 600 molecules/L) of the GHS-R MIMIC added to constant amounts of cDNA from the gonadotroph tumor NT-1. D, Competitive PCR of 2-fold serial dilutions started from the 10-2 10-fold dilution (equal to 6 x 103 molecules/L) of the GHS-R MIMIC added to constant amounts of cDNA from the ACTH-secreting tumor CT-4. E, Competitive PCR of 2-fold serial dilutions started from the 10-1 10-fold dilution (equal to 6 x 104 molecules/L) of the GHS-R MIMIC added to constant amounts of cDNA from the TSH-secreting tumor TT-1. Lanes 2–7 represent the GHS-R MIMIC serial 2-fold dilutions in A–E. The DNA mol wt markers are, from top to bottom, 517, 396, and 344 bp in lane 1 in A–E.

 
The acromegalic tumor AT-4 had a band of equal intensity at 1.5 x 105 mol/LIMIC molecules·L (Fig. 5BGo, lane 3), and the gonadotroph tumor NT-1 was equal at 3 x 102 mol/LIMIC molecules·L (Fig. 5CGo, lane 2); 7.5 x 102 molecules/L MIMIC produced a band equal in intensity to the target cDNA band for the ACTH-secreting tumor CT-4 (Fig. 5DGo, lane 4). The TSH-secreting tumor TT-1 had a band equal to 7.5 x 103 molecules/L (Fig. 5EGo, lane 4).


    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
The majority of human pituitary adenomas are monoclonal neoplasms and originate from a single adenohypophyseal cell (29). The incidence of pituitary tumors is high, but only seldom do they become clinically evident or malignant. There is evidence that many hypothalamic factors exist that may control the growth of pituitary adenomas (30). For example, tumor shrinkage after administration of dopamine agonists to prolactinomas (31) or of somatostatin analogs to somatotroph cell adenomas (32) supports the concept that hypothalamic hormones and their receptors play a role in pituitary tumor progression.

Whereas SSTR2 and GHRH-R gene expression have been demonstrated in pituitary adenomas (33, 34, 35), little is known about the occurrence of the GHS-R in these tumors. As the natural ligand of this receptor has not yet been found, the measurement of its receptor provides a mechanism to gather information about this system. Using RT-PCR and semiquantitative RT-PCR analysis, we present data which show that GHS-R, GHRH-R, and SSTR2 mRNA are expressed in normal human pituitary tissue and in a variety of pituitary tumors, including GH-, TSH-, and ACTH-secreting tumors, as well as nonfunctioning pituitary tumors. Specifically, a GHS-R PCR product was detected in all acromegalic tumors, in three of four ACTH-secreting tumors, and in one third of the nonfunctioning tumors. As there was only one TSH-secreting tumor, it is not possible to assess the prevalence of GHS-R mRNA in this tissue type. GHS-R mRNA expression was 200-fold higher in the somatotroph tumor and 10-fold higher in the TSH-secreting tumor than that in normal pituitary tissue. The other pituitary tumors (ACTH secreting and nonfunctioning) showed levels in the same range or lower than normal pituitary tissue. These results suggest that the somatotroph cell is the main target cell at the pituitary level for the natural ligand of the GHS-R, which plays a less important role in the development of nonsecreting tumors.

The presence of GHS-R mRNA in somatotroph cells suggests that GHSs can act directly on pituitary cells to stimulate GH release. This result concurs with earlier demonstrations that the GHSs are able to directly stimulate GH release from rat primary pituitary cells in vitro (36) and in acromegalic subjects (37). In addition, Renner et al. (38) showed that GH secretion was stimulated by the secretagogue GHRP-6 in 100% of 12 different somatotroph adenoma cell cultures, whereas only a subset of the adenomas responded to GHRH, TRH, or octreotide. This suggests that GHS-R and its signaling pathway are expressed more consistently in somatotroph adenoma cells than are receptors and signaling pathways for GHRH, TRH, and somatostatin. In a recent report by Adams et al. (39), GHS-R mRNA was detected in 6 human pituitary somatotropinomas by RT-PCR, 4 of which hydrolyzed phosphatidylinositol and secreted GH in response to GHRP-2 in vitro. In addition, 3 prolactinomas expressed GHS-R, with 2 of the tumors showing significant stimulation of PRL secretion and phosphatidylinositol hydrolysis in culture. The rat pituitary tumor cell line GH3 was also found to express GHS-R mRNA, but these cells did not respond to GHRPs. This group was unable to detect GHS-R mRNA in 8 functionless human pituitary tumors. The RT-PCR results of the 6 somatotropinomas are consistent with our RT-PCR data that all somatotroph adenomas are positive for GHS-R. Our semiquantitative data also demonstrate that the receptor is expressed at a much higher level in somatotroph adenomas than in normal pituitary, which consists of a mixture of cell types. We were, however, able to detect GHS-R in 1 of 3 gonadotroph tumors by RT-PCR. When examined by semiquantitative competitive PCR, the gonadotroph tumor NT-1 had only 300 GHS-R molecules/µL. This is 2.5-fold fewer than the 750 GHS-R molecules/µL observed in normal pituitary tissue. Perhaps it is the low level of GHS-R in gonadotroph tumors that caused this discrepancy in results. We also detected GHS-R in 75% of ACTH-secreting tumors and in 1 TSH-secreting tumor. The ACTH-secreting tumor CT-4 had 750 GHS-R molecules/µL, equal to that in normal pituitary, whereas the TSH-secreting tumor expressed GHS-R at levels 10-fold higher than normal. These results are consistent with our findings that not only are all somatotroph adenomas positive for GHS-R, but the receptor is expressed at a much higher level than in normal pituitary, which consists of a mixture of cell types.

However, the other pituitary tumors (ACTH secreting and nonfunctioning) showed GHS-R levels in the same range or lower than those in normal pituitary tissue. The existence of increased levels of GHS-R in somatotroph adenomas might explain why patients with acromegaly exhibit major GH discharges to GHRP despite the fact that high GH levels decrease GHS-R in the hypothalamus (24), but only some patients respond similarly to GHRH (40). This suggests a lack of GHS-R down-regulation in the neoplastic somatotroph that has been previously described for the GHRH-R (41, 42). Thapar et al. (42) also demonstrated that overexpression of the GHRH gene in the pituitary is associated with neoplastic progression and clinical aggressiveness of somatotroph adenomas. Whether such a potential role exists for the natural ligand of the GHS-R in the development of somatotroph adenomas requires further study.

Our observation that GHS-R mRNA is present in 75% of the ACTH-secreting pituitary tumors is consistent with the findings of animal and human studies, which showed that the administration of GH secretagogues increased ACTH and cortisol levels (43, 44). Ghigo and colleagues (44) have speculated that 1) the ACTH-releasing activity of GHRP might be used in differentiating pituitary from ectopic ACTH-dependent Cushing’s syndrome; and 2) GHRP stimulates at least in part ACTH in Cushing’s disease, independent of CRH-mediated mechanisms. Our results support the latter conclusion. However, as not all ACTH-secreting adenomas expressed GHS-R mRNA, the utility of GHRP as a diagnostic tool to differentiate between ectopic and pituitary tumors is questionable.

Measurement of GHS-R and the assignment of this receptor to different tumor types may lead to the selective use of a receptor-antagonist as seen with the competitive antagonist of GHRH, (N-Ac-Tyr1,D-Arg2)GHRH-(1–29)NH2, which suppressed the GH concentration in a patient with acromegaly and ectopic GHRH secretion (45), and the GHRH antagonists MZ-4-71 and MZ-5-156, which inhibited elevated GH levels caused by overproduction of human GHRH in transgenic mice (46). Therefore, the demonstration of the GHS-R and its quantification might provide valuable information for future therapeutic approaches in the medical treatment of somatotroph pituitary adenomas.

The quantitative screening of a large number of pituitary tumors and correlation with clinical outcome will provide further information about the involvement of the GHS/GHS-R system in the development and neoplastic progression of pituitary adenomas.


    Acknowledgments
 
We thank Dr. Susan Kirk for assistance in collecting data and for discussion of the significance of the observations, and Drs. Alan Dalkin and Richard Day for advice regarding PCR methodologies.


    Footnotes
 
1 This work supported in part through a gift from Sal and Francince Ranieri and a grant from the Deutsche Forschungsgemeinschaft (Na 317/1-1 and Na 317/1-2; to R.N.). Back

Received June 15, 1998.

Revised August 19, 1998.

Accepted August 31, 1998.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Yamada Y, Reisine T, Law SF, et al. 1992 Somatostatin receptors, an expanding gene family: cloning and functional characterization of human SSTR3, a protein coupled to adenylyl cylcase. Mol Endocrinol. 6:2136–2142.[Abstract]
  2. Buscail L, Delesque N, Esteve JP, et al. 1994 Stimulation of tyrosine phosphatase and inhibition of cell proliferation by somatostatin analogues: mediation by human somatostatin receptor subtypes SSTR1 and SSTR2. Proc Natl Acad Sci USA. 91:2315–2319.[Abstract/Free Full Text]
  3. Jakobs KH, Aktories K, Schultz G. 1983 A nucleotide regulatory site for somatostatin inhibition of adenylyl cylclase in S49 lymphoma cells. Nature. 303:177–178.[CrossRef][Medline]
  4. Dhanasekaran N, Heasley LE, Johnson GL. 1995 G protein-coupled receptor systems involved in cell growth and oncogenesis. Endocr Rev. 16:259–270.[CrossRef][Medline]
  5. Burton KA, Kabigting EB, Clifton DK, Steiner RA. 1992 Growth-hormone receptor messenger-ribonucleic-acid distribution in the adult male-rat brain and its colocalization in hypothalamic somatostatin neurons. Endocrinology. 131:958–963.[Abstract]
  6. Bennett PA, Levy A, Sophokleous S, Robinson ICAF, Lightman SL. 1995 Hypothalamic GH receptor gene expression in the rat: effects of altered GH status. J Endocrinol. 147:225–234.[Abstract/Free Full Text]
  7. Smith RG, Cheng K, Pong SS, et al. 1996 Mechanism of action of GHRP-6 and nonpeptidyl growth hormone secretagogues. In: Bercu BB, Walker RF, eds. Growth hormone secretagogues. New York: Springer-Verlag; 147–163.
  8. Smith RG, Van der Ploeg LHT, Howard AD, et al. 1997 Peptidomimetic regulation of growth hormone secretion. Endocr Rev. 18:621–645.[Abstract/Free Full Text]
  9. Dickson SL, Leng G, Dyball REJ, Smith RG. 1995 Central actions of peptide and nonpeptide growth hormone secretagogues in the rat. Neuroendocrinology. 61:36–43.[Medline]
  10. Dickson SL, Luckman SD. 1997 Induction of c-fos messenger ribonucleic acid in neuropeptide Y and growth hormone (GH)-releasing factor neurones in the rat arcuate nucleus following systemic injection of the GH secretagogue, GH-releasing peptide-6. Endocrinology. 138:771–777.[Abstract/Free Full Text]
  11. Fletcher TP, Thomas GB, Clarke IJ. 1996 Growth hormone-releasing hormone and somatostatin concentrations in the hypophysial portal blood of conscious sheep during the infusion of growth hormone-releasing peptide-6. Dom Anim Endocrinol. 13:251–258.[CrossRef][Medline]
  12. Guillaume V, Magnan E, Cataldi M, et al. 1994 Growth hormone (GH)-releasing hormone secretion is stimulated by a new GH-releasing hexapeptide in sheep. Endocrinology. 135:1073–1076.[Abstract]
  13. Bowers CY, Momany FA, Reynolds GA, Hong A. 1984 On the in vitro and in vivo activity of a new synthetic hexapeptide that acts on the pituitary to specifically release growth hormone. Endocrinology. 114:1537–1545.[Abstract]
  14. Cheng K, Chan WWS, Butler BS, Barreto A, Smith RG. 1989 The synergistic effects of His-D-Trp-Ala-Trp-D-Phe-Lys-NH2 on GRF stimulated growth hormone release and intracellular cAMP accumulation in rat primary pituitary cell cultrues. Endocrinology. 124:2791–2797.[Abstract]
  15. Smith RG, Pong SS, Hickey GJ, et al. 1996 Modulation of pulsatile GH release through a novel receptor in hypothalamus and pituitary gland. Recent Prog Horm Res. 51:261–286.
  16. Pong SS, Chaung LYP, Leonard RJ. The involvement of ions in the activity of a novel growth hormone secretagogue L-692,429 in rat pituitary cell culture. Proc of the 75th Annual Meet of The Endocrine Soc. 1993; 487.
  17. Bresson-Bepoldin L, Dufy-Barbe L. 1994 GHRP-6 induces a biphasic calcium response in rat pituitary somatotrophs. Cell Calcium. 15:247–258.[CrossRef][Medline]
  18. Herrington J, Hille B. 1994 Growth hormone-releasing hexapeptide elevates intracellular calcium in rat somatotrophs by two mechanisms. Endocrinology. 135:1100–1108.[Abstract]
  19. Lei T, Buchfelder M, Fahlbusch R, Adams EF. 1995 Growth hormone releasing peptide (GHRP-6) stimulates phosphatidylinositol (PI) turnover in human pituitary somatotroph cells. J Mol Endocrinol. 14:135–138.[Abstract/Free Full Text]
  20. Cheng K, Chan WWS, Butler BS, Barreto A, Smith RG. 1991 Evidence for a role of protein kinase-C in His-D-Trp-Ala-Trp-D-Phe-Lys-NH2-induced growth hormone release from rat primary pituitary cells. Endocrinology. 129:3337–3342.[Abstract]
  21. Howard AD, Feighner SD, Cully DF, et al. 1996 A receptor in pituitary and hypothalamus that functions in growth hormone release. Science. 273:974–977.[Abstract]
  22. Guan XM, Hong Y, Palyha OC, et al. 1997 Distribution of mRNA encoding the growth hormone secretagogue receptor in brain and peripheral tissues. Mol Brain Res. 48:23–29.[Medline]
  23. Shimon I, Yan X, Melmed S. 1998 Human fetal pituitary expresses functional growth hormone-releasing peptide receptors. J Clin Endocrinol Metab. 83:174–178.[Abstract/Free Full Text]
  24. Bennett PA, Thomas GB, Howard AD, et al. 1997 Hypothalamic growth hormone secretagogue-receptor (GHS-R) expression is regulated by growth hormone in the rat. Endocrinology. 138:4552–4557.[Abstract/Free Full Text]
  25. Herman V, Fagin J, Gonsky R, Kovacs K, Melmed S. 1990 Clonal origin of pituitary adenomas. J Clin Endocrinol Metab. 71:1427–1433.[Abstract]
  26. Reichlin S. 1980 Etiology of pituitary adenomas. In: Post KD, Jackson IMD, Reichlin S, eds. The pituitary adenoma. New York and London: Plenum Press; 29–42.
  27. Alexander JM, Biller BMK, Bikkal H, Zervas NT, Arnold A, Klibanski A. 1990 Clinically nonfunctioning pituitary tumors are monoclonal in origin. J Clin Invest. 86:336–340.
  28. Biller BM, Alexander JM, Zervas NT, Hedley-Whyte ET, Arnold A, Klibanski A. 1992 Clonal origins of adrenocorticotropin-secreting pituitary tissue in Cushing’s disease. J Clin Endocrinol Metab. 75:1303–1309.[Abstract]
  29. Shimon I, Melmed S. 1997 Genetic basis of endocrine disease: pituitary tumor pathogenesis. J Clin Endocrinol Metab. 82:1675–1681.[Free Full Text]
  30. Faglia G, Spada A. 1995 The role of the hypothalamus in pituitary neoplasia. Bailliere Clin Endocrinol Metab. 9:225–242.[CrossRef][Medline]
  31. Molitch ME. 1995 Prolactinoma. In: Melmed S, ed. The pituitary. Cambridge: Blackwell; 443–477.
  32. Ezzat S, Snyder PJ, Young WF, et al. 1992 Octreotide treatment of acromegaly: a randomized, multicenter study. Ann Intern Med. 117:711–718.
  33. Miller GM, Alexander JM, Bikkal HA, Katznelson L, Zervas NT, Klibanski A. 1995 Somatostatin receptor subtype gene expression in pituitary adenomas. J Clin Endocrinol Metab. 80:1386–1392.[Abstract]
  34. Lopes MB, Gaylinn BD, Thorner MO, Stoler MH. 1997 Growth hormone-releasing hormone receptor mRNA in acromegalic pituitary tumors. Am J Pathol. 150:1885–1891.[Abstract]
  35. Greenman Y, Melmed S. Heterogeneous expression of two somatostatin receptor subtypes in pituitary tumors. J Clin Endocrinol Metab. 78:398–403.
  36. Cheng K, Chan WW, Butler B, et al. 1993 Stimulation of growth hormone release from rat primary pituitary cells by L-692,429, a novel non-peptidyl GH secretagogue. Endocrinology. 132:2729–2731.[Abstract]
  37. Popovic V, Damjanovic S, Micic D, Petakov M, Dieguez C, Casanueva FF. 1994 Growth hormone (GH) secretion in active acromegaly after the combined administration of GH-releasing hormone and GH-releasing peptide-6. J Clin Endocrinol Metab. 79:456–460.[Abstract]
  38. Renner U, Brockmeier S, Strasburger CJ, et al. 1994 Growth hormone (GH)-releasing peptide stimulation of GH release from human somatotroph adenoma cells: interaction with GH-releasing hormone, thyrotropin-releasing hormone, and octreotide. J Clin Endocrinol Metab. 78:1090–1096.[Abstract]
  39. Adams EF, Huang B, Buchfelder M, et al. 1998 Presence of growth hormone secretagogue receptor messenger ribonucleic acid in human pituitary tumors and rat GH3 cells. J Clin Endocrinol Metab. 83:638–642.[Abstract/Free Full Text]
  40. Alster DK, Bowers CY, Jaffe CA, Ho PJ, Barkan AL. 1993 The growth hormone (GH) response to GH-releasing peptide (His-DTrp-Ala-Trp-DPhe-Lys-NH2), GH-releasing hormone, and thyrotropin-releasing hormone in acromegaly. J Clin Endocrinol Metab. 77:842–845.[Abstract]
  41. Spada A, Elahi FR, Arosio M, et al. 1987 Lack of desensitization of adenomatous somatotrophs to growth-hormone releasing hormone in acromegaly. J Clin Endocrinol Metab. 64:585–591.[Abstract]
  42. Thapar K, Kovacs K, Stefaneanu L, et al. 1997 Overexpression of the growth-hormone-releasing hormone gene in acromegaly-associated pituitary tumors. Am J Pathol. 1551:769–784.
  43. Jacks T, Hickey G, Judith F, et al. 1994 Effects of acute and repeated intravenous administration of L-692,585, a novel non-peptidyl growth hormone secretagogue, on plasma growth hormone, IGF-1, ACTH, cortisol, prolactin, insulin, and thyroxine levels in beagles. J Endocrinol. 143:399–406.[Abstract/Free Full Text]
  44. Ghigo E, Arvat E, Ramunni J, et al. 1997 Adrenocorticotropin- and cortisol-releasing effect of hexarelin, a synthetic growth hormone-releasing peptide, in normal subjects and patients with Cushing’s syndrome. J Clin Endocrinol Metab. 82:2439–2444.[Abstract/Free Full Text]
  45. Jaffe CA, DeMott-Friberg R, Frohman LA, Barkan AL. 1997 Suppression of growth hormone (GH) hypersecretion due to ectopic GH-releasing hormone (GHRH) by a selective GHRH antagonist. J Clin Endocrinol Metab. 82:634–637.[Abstract/Free Full Text]
  46. Kovacs M, Kineman RD, Schally AV, Zarandi M, Groot K, Frohman LA. 1997 Effects of antagonists of growth hormone-releasing hormone (GHRH) on GH and insulin-like growth factor I levels in transgenic mice overexpressing the human GHRH gene, an animal model of acromegaly. Endocrinology. 138:4536–4542.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
H D. Falls, B. D Dayton, D. G Fry, C. A Ogiela, V. G Schaefer, S. Brodjian, R. M Reilly, C. A Collins, and W. Kaszubska
Characterization of ghrelin receptor activity in a rat pituitary cell line RC-4B/C.
J. Mol. Endocrinol., August 1, 2006; 37(1): 51 - 62.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. D. Dixit, A. T. Weeraratna, H. Yang, D. Bertak, A. Cooper-Jenkins, G. J. Riggins, C. G. Eberhart, and D. D. Taub
Ghrelin and the Growth Hormone Secretagogue Receptor Constitute a Novel Autocrine Pathway in Astrocytoma Motility
J. Biol. Chem., June 16, 2006; 281(24): 16681 - 16690.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. J. Martinez-Fuentes, J. Moreno-Fernandez, R. Vazquez-Martinez, M. Duran-Prado, A. de la Riva, M. Tena-Sempere, C. Dieguez, L. Jimenez-Reina, S. M. Webb, A. Pumar, et al.
Ghrelin Is Produced by and Directly Activates Corticotrope Cells from Adrenocorticotropin-Secreting Adenomas
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2225 - 2231.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
V. Tolle, M.-H. Bassant, P. Zizzari, F. Poindessous-Jazat, C. Tomasetto, J. Epelbaum, and M.-T. Bluet-Pajot
Ultradian Rhythmicity of Ghrelin Secretion in Relation with GH, Feeding Behavior, and Sleep-Wake Patterns in Rats
Endocrinology, April 1, 2002; 143(4): 1353 - 1361.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Murata, Y. Okimura, K. Iida, M. Matsumoto, H. Sowa, H. Kaji, M. Kojima, K. Kangawa, and K. Chihara
Ghrelin Modulates the Downstream Molecules of Insulin Signaling in Hepatoma Cells
J. Biol. Chem., February 8, 2002; 277(7): 5667 - 5674.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. L. Brinkmeier, J. H. Stahl, D. F. Gordon, B. D. Ross, V. D. Sarapura, J. M. Dowding, S. K. Kendall, R. V. Lloyd, E. C. Ridgway, and S. A. Camper
Thyroid Hormone-Responsive Pituitary Hyperplasia Independent of Somatostatin Receptor 2
Mol. Endocrinol., December 1, 2001; 15(12): 2129 - 2136.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Petersenn, A. C. Rasch, M. Penshorn, F. U. Beil, and H. M. Schulte
Genomic Structure and Transcriptional Regulation of the Human Growth Hormone Secretagogue Receptor
Endocrinology, June 1, 2001; 142(6): 2649 - 2659.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X.-d. Peng, S. Park, M. R. Gadelha, K. T. Coschigano, J. J. Kopchick, L. A. Frohman, and R. D. Kineman
The Growth Hormone (GH)-Axis of GH Receptor/Binding Protein Gene-Disrupted and Metallothionein-Human GH-Releasing Hormone Transgenic Mice: Hypothalamic Neuropeptide and Pituitary Receptor Expression in the Absence and Presence of GH Feedback
Endocrinology, March 1, 2001; 142(3): 1117 - 1123.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Korbonits, S. A. Bustin, M. Kojima, S. Jordan, E. F. Adams, D. G. Lowe, K. Kangawa, and A. B. Grossman
The Expression of the Growth Hormone Secretagogue Receptor Ligand Ghrelin in Normal and Abnormal Human Pituitary and Other Neuroendocrine Tumors
J. Clin. Endocrinol. Metab., February 1, 2001; 86(2): 881 - 887.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skinner, M. M.
Right arrow Articles by Thorner, M. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skinner, M. M.
Right arrow Articles by Thorner, M. O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals