help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gicquel, C.
Right arrow Articles by Le Bouc, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gicquel, C.
Right arrow Articles by Le Bouc, Y.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 5 1472-1476
Copyright © 1998 by The Endocrine Society


Original Studies

Assessment of Turner’s Syndrome by Molecular Analysis of the X Chromosome in Growth-Retarded Girls1

Christine Gicquel, Véronique Gaston, Sylvie Cabrol and Yves Le Bouc

Laboratoire d’Explorations Fonctionnelles Endocriniennes, Hôpital Trousseau, 75012 Paris, France

Address all correspondence and requests for reprints to: Dr. Christine Gicquel, Laboratoire d’Explorations Fonctionnelles Endocriniennes, Hôpital Trousseau, 26 Avenue Arnold Netter, 75012 Paris, France.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Turner’s syndrome (TS) is a common disorder (1/2500 to 1/5000 female births) which is diagnosed at birth in approximately 20% of patients and during childhood or at puberty for the rest. Growth retardation is the most frequent clinical feature of TS, so we systematically searched for TS in female patients referred to our center because of short stature. Three hundred seventy-five female patients, 1 month to 18 yr old (mean ± SD = 97/12 ± 39/12), with growth retardation (less than -2 SD) and/or decreased height velocity were included in the study. Mean growth retardation was -2.57 SD ± 0.79 (range: -1 to -7). Thirty-two percent of the patients had reached puberty. GH provocative tests were performed in 329 patients (87.7%), and 36 of these patients (11%) had impaired GH secretion (5 complete and 31 partial GH deficiency).

TS was evaluated by Southern blot analysis of leukocyte DNA using a multiallelic polymorphic X chromosome marker (88% heterozygosity rate). Y chromosome PCR analysis was carried out if a pattern indicative of TS was obtained. Leukocyte DNA analysis produced an abnormal restriction pattern for 20 of the 375 cases (5.3%). There was a single hybridizing band in 13 cases, an allelic disproportion indicative of mosaicism in 6 cases, and 3 hybridizing bands in 1 case. One patient tested positive in the Y chromosome PCR analysis. Cytogenetic analysis showed 47 XXX trisomy in the patient with a 3-hybridizing-band pattern and confirmed the diagnosis of TS for 17 of the 19 suspected cases: 45 X: n = 7; 45 X/46 Xi(Xq): n = 4; 45 X/46 XX: n = 2; 46 Xi(Xq): n = 1; 45 X/46 Xr(X): n = 1; 45 X/46 XX/47 XXX: n = 1; 45 X/46 XY: n = 1. Cytogenetic analysis was normal (46 XX) for the 2 other patients.

The TS phenotype is variable: dysmorphism is often missing or mild (particularly in cases of mosaicism), but growth is reduced in virtually all patients. Screening of 375 growth-retarded girls identified 18 cases of TS, of which 17 were diagnosed by molecular analysis. This incidence (4.8%) was significantly higher than the expected incidence in this population (0.8–1.6%: P < 0.001).


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
TURNER’S syndrome (TS) is one of the most common chromosomal abnormalities, its incidence being between 1/2500 and 1/5000 live births among girls (1). Twenty percent of the cases are diagnosed at birth because of typical clinical features or somatic abnormalities (2, 3), which are often related to 45 X monosomy. Diagnosis of the remaining patients is made during childhood (usually because of growth retardation) or later (because of lack of pubertal development). In approximately 50% of the cases, the karyotype anomaly is 45 X monosomy, but a variety of other anomalies, including mosaicism, Xp or Xq deletion, and isochromy of the X long arm are known (4).

Recombinant DNA technology makes possible the analysis of sex chromosome abnormalities at the molecular level. It has helped to identify the parental origin of the abnormality, the existence of cytogenetically hidden mosaicism, and the correlation between genotype and phenotype (5, 6, 7).

Recognition of the disease is important, in view of GH therapy, as is precise diagnosis of the chromosome anomalies responsible for the varying prognoses, in terms of growth and fertility. Growth response would be negatively correlated with age at the start of therapy (8, 9), and so, early diagnosis of TS is important.

Short stature is the most common clinical feature of TS, and the aim of this work was to systematically search for TS in female patients referred on the basis of short stature. Three hundred and seventy-five patients were investigated. We tested for TS by Southern blot analysis of leukocyte DNA with a highly polymorphic marker of the X chromosome (10). Eighteen patients were diagnosed with TS (17 by molecular analysis). Fourteen of theses patients had no clinical features indicative of TS. One of these patients also tested positive for chromosome Y by PCR. The incidence of TS in this population (4.8%) was higher than the expected incidence of TS in a female population of short stature (0.8–1.6%). We could not define a population for molecular diagnosis screening based on clinical, auxological, or hormonal data; but this study suggests that patients with mild growth retardation should be tested for TS.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Patients

Clinical data. Growth-retarded patients referred to our center for TS or chronic illness (respectively, 23 and 42 patients for the same period) were not included in this study.

Three hundred seventy-five girls, 1 month to 18 yr old (mean ± SD = 9 7/12 ± 39/12), were referred to our center for investigation of growth retardation. Mean growth retardation was -2.57 SD ± 0.79 (range: -1 to -7). Forty-nine patients had growth retardation less than -2 SD, according to French growth charts (11), but exhibited a decreased height velocity.

Pubertal stage was available for 370 of the patients. Six percent (n = 23) were postpubertal and 25.7% (n = 95) were at puberty at the time of molecular analysis. Two patients exhibited precocious puberty.

Birth length was recorded for 330 of the 375 patients. Two hundred and sixty-four were full-term babies, and their mean birth length was 47.8 ± 2.05 cm. Twenty-five percent of the patients (n = 83/330) had birth lengths below the third percentile (12).

Mean maternal height (n = 363) was 157.5 ± 6.8 cm (138–180 cm), and mean paternal height (n = 360) was 169.7 ± 7.4 cm (150–190 cm). These parental heights were slightly lower than the mean French adult heights, which are 163.2 ± 5.6 cm for women and 174.5 ± 6 cm for men.

Eighty percent (n = 300) had no clinical features of TS. Twenty percent (n = 75) had clinical features consistent with TS. Sixty-three of these patients had one of the following features: mild cubitus valgus, short neck, widely separated nipples, pigmented nevi, or short 4th metacarpal bone. Twelve had a more suggestive Turner’s dysmorphia, with square thorax and two of the other features.

Hormonal data. GH provocative tests were performed in 329 patients (87.7%). The first test for most patients (97%) was an ornithine stimulation test. An impaired GH response to the first provocative test (peak GH level below 10 ng/mL) was found in 70 (21.3%) patients. A second test [insulin induced hypoglycemia or sequential test (arginine-insulin tolerance test or betaxolol-glucagon stimulation test)] was performed in 64 of these 70 patients. This led to the diagnosis of complete GH deficiency (peak GH level below 5 ng/mL) in 5 patients and the diagnosis of partial GH deficiency (peak GH level below 10 ng/mL) in 31 patients.

Thyroid function was investigated in 364 patients (97%) and was normal for all patients, except two with treated congenital hypothyroidism.

Methods

Molecular analysis Preparation of genomic DNA.
Leukocyte DNA was isolated from 10-mL blood samples collected in EDTA and extracted as previously described (10).

Southern-blot analysis
DNA (10 µg) was digested with 100 U EcoRI (New England Biolabs, Beverly, MA), and the digested DNA was analyzed by Southern blotting, as previously described (10).

Hybridization was carried out using the X-chromosome M27ß probe, which maps to Xcen-p11.22 in a variable number tandem repeat region and recognizes a highly informative (88%) multiallelic polymorphism (13).

Hybridization signals were quantified by densitometric analysis, using a GS700 imaging densitometer and the molecular analyst data system (Bio-rad, Rockland, CA), in comparison with two female reference DNAs (a homozygous 46 XX and a heterozygous 46 XX) and a male reference 46 XY DNA. A single band of reduced intensity (50% of the homozygous 46 XX control DNA) indicates the presence of a single X chromosome. Two bands of different intensities indicate mosaicism. The use of Southern-blot analysis with the M27ß probe has been previously shown to be accurate for the diagnosis of TS, the drawback being its inability to recognize the distal Xp deletion (10).

PCR analysis.
Four different loci of the Y chromosome, the open reading frame of the SRY gene (Yp11.3), the ZFY gene (Yp11.3), the DYZ3 sequence (Y centromere), and the repeated sequence DYZ1 (Yq12) were studied. Sense and antisense primers were, respectively, 5'-GTCGCACTCTCCTTGTTTTTTGAC and 5'- CCGATTGTCCTACAGCTTTGTC for SRY (648 bp), 5'-AATTCATGAGGAGACC-AGAAG and 5'-CACAGAATTTACACTTGTGCAT for ZFY (400 bp), 5'-ATGATA-GAACGGAAATATG and 5'-AGTAGAATGCAAAGGGCTCC for DYZ1 (170 bp), 5'-TCCACTTTATTCCAGGCCTGTCC and 5'-TTGAATGGAATGGGAACGAATGG for DYZ1 (154 bp).

Amplified samples were subjected to electrophoresis in a 1.5% agarose gel, stained with ethidium bromide.

Karyotype. Karyotype analysis and fluorescence in situ hybridization (FISH) were done as previously described (14, 15). X chromosome FISH analysis was performed using a DXZ1 probe.

Statistical analysis. If binary variables were examined, between-group comparisons were made using a chiquare test for two independent samples. The Fisher’s exact test was used if necessary.

Comparison of the distribution of a continuous variable was tested using the nonparametric Kolmogorov-Smirnov test.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Restriction profiles of the X chromosome in patients with growth retardation

Normal restriction patterns were found in 355 (94.7%) of the patients (Table 1Go). Eighty-eight percent of these patients (n = 311) were heterozygous for the X chromosome marker, with two bands of the same intensity, and twelve percent (n = 44) were homozygous (Fig. 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Southern blot restriction patterns in female patients with growth retardation

 


View larger version (65K):
[in this window]
[in a new window]
 
Figure 1. Southern blot analysis of patients with growth retardation. Ten micrograms of leukocyte DNA restricted with EcoRI. The blot was hybridized with the M27ß probe.

 
Despite their normal restriction profiles, karyotype analysis was performed in 85 of these 355 patients. Karyotype analysis was generally performed for patients with the most severe growth retardation (mean ± SD = -2.8 ± 0.8 in the group of 85 patients with karyotype analysis, and -2.46 ± 0.7 in the group of 270 patients without karyotype analysis), to exclude a distal Xp deletion that cannot be detected by the molecular technique. There was a normal karyotype for 84 of them and one 45 X/46 XX mosaicism with only 4% 45 X cells, which were identified after a second karyotype analysis using 50 cells (Table 1Go).

Abnormal restriction patterns were found in 20 (5.3%) of the patients (Table 1Go).

Thirteen had a single hybridization band of 50% reduced intensity, compared with the homozygous reference 46 XX DNA (Fig. 1Go). Cytogenetic analyses are presented in Table 1Go. One of these patients had a normal chromosomal formula (false positive).

In 6 cases, there were 2 bands of different intensities, suggesting that there was mosaicism (Fig. 1Go). The karyotype analysis of 5 of these 6 patients confirmed the mosaicism TS: 45 X/46 XX, 45 X/46 XX, 45 X/46 Xr(X), 45 X/46 Xi(Xq), and 45 X/46 XX/47 XXX (Table 1Go), with (respectively) 15%, 50%, 60%, 50%, and 90% blood cell population carrying 45 X. The 2-bands pattern of the 45 X/46 Xi(Xq) mosaicism is caused by a dicentric isochromy of the long arm of X chromosome with maintenance of a part of the short arm. In the sixth case (false positive), the restriction pattern was indicative of a mosaicism with 10% 45 X cells, but karyotype analysis of 48 cells was normal.

In 1 case, there was a three-band pattern (Fig. 1Go). Karyotype analysis showed there was a 47 XXX trisomy (Table 1Go).

These data also indicate the good accuracy of molecular diagnosis, with a sensitivity of 94.7% (5.2% false negatives) and a specificity of 97.7% (2.3% false positives).

Y chromosome PCR analysis

PCR analysis was performed for patients with an X-chromosome restriction pattern indicative of TS. One patient tested positive for the Y chromosome, by PCR analysis, with the characteristic bands of the four Y loci studied. There was no clinical or biological hyperandrogenism in this patient. Karyotype analysis with Y chromosome FISH detected a 10% 46 XY cell population.

Correlation of clinical, auxological, hormonal, molecular, and cytogenetic data

Differences in age at diagnosis (Fig. 2AGo), birth length (Fig. 2BGo) or severity of growth retardation (Fig. 2CGo), were studied in patients diagnosed with TS and growth-retarded girls without TS. We found that TS patients who were undiagnosed at birth were referred late to our center (mean age at diagnosis: 98/12 ± 4 yr) at the same age than patients without TS (97/12 ± 310/12 yr). Birth length was normal for 43.75% of TS patients, and there was no significant difference in mean birth length between the two groups. However, Fig. 2BGo shows a bimodal distribution for birth length in TS girls with 50% (8/16) less than 46 cm. The growth retardation of 33% of TS patients was within 2 SD of normal, and mean growth retardation was not significantly different between the two groups. Finally none of these variables made it possible to select a defined population for molecular analysis.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Comparison of age at the diagnosis (A), birth length (B), and growth retardation (C) in patients diagnosed with TS and in all patients with growth retardation. TS, patients diagnosed as TS; GR patients, growth-retarded patients without TS.

 
Patients were classified into 3 groups, according to clinical phenotype: group A (n = 300), without Turner’s phenotype; group B (n = 63), with only 1 feature of Turner’s phenotype restricted to mild cubitus valgus, short neck, widely separated nipples, pigmented nevi, or short 4th metacarpal bone; and group C (n = 12), with a more suggestive Turner’s phenotype (Table 2Go). Karyotype analysis was performed in 105 of 375 patients. The variable percentage of patients that had karyotypes in each group (20.3% in group A, 54% in group B, and 83.3% in group C) was determined by a more severe growth retardation and/or TS-like feature(s). There was a significantly higher rate of TS (P < 0.001) in patients with TS-like feature(s) (groups B and C), even if only one feature (group B) was present. However, 7 TS (including 45 X monosomy) were found in patients without any clinical features indicative of TS, except growth retardation (Table 2Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Clinical features indicative of Turner’s syndrome in patients with growth retardation

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
TS is one of the most frequent chromosome abnormalities and, recognition of the disease is important for GH therapy (8, 9). Growth response is negatively correlated with age at the start of therapy and duration of treatment (8, 16). Thus, early diagnosis of TS is important. Short stature is a symptom in 98% of cases of TS, but dysmorphia is often absent (4). It is, thus, important to accurately assess the incidence of TS in growth-retarded girls.

We have previously demonstrated the routine use of Southern-blot analysis for diagnosis of TS and used the same tool to screen for TS in a growth-retarded female population. In the previous study, the sensitivity of the test was estimated to be 92% and its specificity, 100% (10).

The frequency of TS is between 1/2500 and 1/5000 female live births (1), and growth is reduced in virtually all TS patients. Growth retardation (<=-2 SD) affects 2.5% of the whole female population; thus, the theorical frequency of TS in growth-retarded girls was estimated to be between 0.8 and 1.6%. This theorical frequency is actually overrated for two reasons: 1) 20% of TS cases are diagnosed at birth; and 2) patients referred to our center for TS were excluded, and only patients referred for growth retardation were included in this study. Thus, the expected frequency of TS in growth-retarded girls is probably below 1%. A Scottish study (17) of 2- to 4-yr-old children used diagnostic tests (and particularly conventional chromosome analysis) on girls with heights below -2.5 SD. With these criteria, one TS case was detected in a group of 208 growth-retarded girls.

In this study, we diagnosed 18 (4.8%) cases of TS in a group of 375 girls, 17 of which were diagnosed by molecular analysis. This incidence is significantly higher than the expected incidence (0.8–1.6%; P < 0.001).

Many authors have suggested that 45 X monosomy is lethal and that most surviving 45 X individuals are actually mosaicisms undetected by cytogenetic tests. The prevalence of micromosaicism recorded for TS patients depends on the methods used and the number of tissues screened (7). 45 X monosomy is usually detected in 50% of patients with TS, and mosaicism and X anomaly are detected in the other half. In this study, mosaicism and X anomaly were detected in 61.1% of the cases of diagnosed TS. These data are consistent with the fact that we selected patients on the basis of growth retardation and that 45 X monosomy is usually diagnosed in the first few years of life because of dysmorphia. However, we detected 45 X monosomy in two patients who had no clinical features consistent with TS (except growth retardation), one of them being at puberty. We also diagnosed five patients with isochromy of the long arm of the X chromosome who had no (n = 1) or only mild (n = 4) Turner’s phenotype. The dissociation between karyotype and phenotype is probably caused by a tissue-confined mosaicism, as previously described in monozygotic triplets (18).

To preselect a group of patients for molecular analysis, we assessed clinical data (such as birth length, age, and severity of growth retardation at the time of molecular diagnosis) and hormonal data in the patients who were diagnosed with TS and in all the other patients with growth retardation. None of these features might allow us to define a group of patients for this analysis. This study showed that 43.75% of patients diagnosed with TS had birth lengths within the normal range. It also showed that 33.3% had moderate growth retardation (within 2 SD of normal). There was impaired GH response to provocative test for 4 of 17 (23.5%) TS patients, and 2 of them were overweighted. Nevertheless, there was a higher frequency of TS (12.7%) for patients with only one of the features of TS (63 patients in this study, group B).

The presence of a Y chromosome or Y-chromosome derivative material in TS is correlated with the risk of gonadoblastoma, and prophylactic gonadectomy could be recommended in these cases (19). Presence of Y-chromosome material accounts for approximately 5% of TS cases (20, 21), but the observed frequency of Y-chromosome material also depends on the methods used (22). The presence of a normal Y chromosome in 10% of blood cells and the lack of clinical virilization and hyperandrogenism in our patient suggest a very low proportion of Y chromosome cells in gonads at the time of gonadal differentiation.

In conclusion, the incidence of TS in this population (4.8%) was higher than the expected incidence of TS in a female population of short stature (0.8–1.6%). It remains to be established whether this higher incidence of TS in patients with growth retardation justifies a systematic screening for TS in growth-retarded girls. In this regard, molecular analysis of the X chromosome is a valuable alternative to cytogenetic analysis in cases where growth retardation is not accompanied by Turner’s phenotype.


    Acknowledgments
 
We thank Drs. B Estéva, M. Gourmelen, M. Houang, T. Pierret, M. C. Raux-Demay, and C. Saab for samples from patients; Dr. M. F. Portnoï for FISH techniques; and Dr. D. Costagliola for statistical analysis.


    Footnotes
 
1 This work was supported by the University of Paris VI, Faculté Saint-Antoine (DRED EA 1531). Back

Received September 17, 1997.

Accepted February 3, 1998.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Gravholt C, Juul S, Naeraa R, Hansen J. 1996 Prenatal and postnatal prevalence of Turner’s syndrome: a registry study. Br Med J. 312:16–21.[Abstract/Free Full Text]
  2. Massa G, Vandershueren-Lodeweyckx M, Malvaux P. 1990 Linear growth in patients with Turner syndrome: influence of spontaneous puberty and parental height. Eur J Pediatr. 149:246–250.[CrossRef][Medline]
  3. Cabrol S, Saab C, Gourmelen M, Raux-Demay M, Le Bouc Y. 1996 Syndrome de Turner: croissance staturopondérale et maturation osseuse spontanées. Arch Pédiatrie. 3:313–318.
  4. Fergusson-Smith M. 1993 Genotype-phenotype correlations in Turner syndrome. In: Hibi I, Takano K, eds. Basic and clinical approach to Turner syndrome. Amsterdam: Elsevier Science; 17–25.
  5. Connor J, Loughlin S. 1989 Molecular genetics of Turner’s syndrome. Acta Paediatr Suppl. 356:77–80.
  6. Chu C, Donaldson M, Kelnar C, et al. 1994 Possible role of imprinting in the Turner phenotype. J Med Genet. 31:840–842.[Abstract/Free Full Text]
  7. Held K, Becker B, Kaminsky E, et al. 1995 Do all Turner individuals have mosaicism? state of the art. In: Albertsson-Wikland K, Ranke M, eds. Turner syndrome in a life span perspective: research and clinical aspects. Amsterdam: Elsevier; 33–39.
  8. Ranke M, Price D, Maes M, Albertsson-Wikland K, Lindberg A. 1995 Factors influencing final height in Turner syndrome following GH treatment: results of the Kabi international growth study (KIGS). In: Albertsson-Wikland K, Ranke M, eds. Turner syndrome in a life span perspective: research and clinical aspects. Amsterdam: Elsevier; 161–165.
  9. Rochiccioli P, Battin J, Bertrand A, et al. 1995 Final height in Turner syndrome patients treated with growth hormone. Horm Res. 44:172–176.[Medline]
  10. Gicquel C, Cabrol S, Schneid H, Girard F, Le Bouc Y. 1992 Molecular diagnosis of Turner’s syndrome. J Med Genet. 29:547–551.[Abstract/Free Full Text]
  11. Sempé M, Pedron G, Roy-Pernot MP. 1979 Auxologie: méthode et séquences. Paris: Laboratoire Théraplix.
  12. Leroy B, Lefort F. 1971 A propos du poids et de la taille des nouveaux-nés à la naissance. Rev Fr Gynecol. 66:391–396.
  13. Fraser N, Boyd Y, Craig I. 1989 Isolation and characterization of a human variable copy number tandem repeat at X cen-p11.22. Genomics. 5:144–148.[CrossRef][Medline]
  14. De Grouchy J, Turleau C. 1984 Clinical atlas of human chromosomes. New York: John Wiley.
  15. Pinkel D, Straume T, Gray J. 1986 Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc Natl Acad Sci USA. 83:2934–2938.[Abstract/Free Full Text]
  16. Rosenfeld R, Frane J, Attie K, et al. 1992 Six year results of a randomized, prospective trial of human growth hormone and oxandrolone in Turner syndrome. J Pediatr. 121:49–55.[CrossRef][Medline]
  17. Vimpani G, Vimpani A, Pocock S, Farquhar J. 1981 Differences in physical characteristics, perinatal histories and social backgrounds between children with growth hormone deficiency and constitutional short stature. Arch Dis Child. 56:922–928.[Abstract]
  18. Lespinasse J, Gicquel C, Robert M, Le Bouc Y. 1997 Mosaicism in 45,X Turner syndrome in triplets: interest of cytogenetic analysis of different tissues and contribution of molecular biology. 1st European Cytogenetics Conference, Athènes. Cytogenet Cell Genet. 77:44.
  19. Verp M, Simpson J. 1987 Abnormal sexual differentiation and neoplasia. Cancer Genet Cytogenet. 25:191–218.[CrossRef][Medline]
  20. Lindgren V, Chen C, Bryke C, Lichter P, Page D, Yang-Feng T. 1992 Cytogenetic and molecular characterization of marker chromosomes in patients with mosaic 45,X karyotypes. Hum Genet. 88:393–398.[CrossRef][Medline]
  21. Medlej R, Lobaccaro J, Berta P, et al. 1992 Screening for Y-derived sex determining gene SRY in 40 patients with Turner syndrome. J Clin Endocrinol Metab. 75:1289–1292.[Abstract]
  22. Binder G, Koch A, Wajs E, Ranke M. 1995 Evaluation of hidden Y-chromosome in Turner syndrome (TS): a review of screening results. In: Albertsson-Wikland K, Ranke M, eds. Turner syndrome in a life span perspective: research and clinical aspects. Amsterdam: Elsevier; 25–32.



This article has been cited by other articles:


Home page
Arch. Dis. Child.Home page
S van Buuren, P van Dommelen, G R J Zandwijken, F K Grote, J M Wit, and P H Verkerk
Towards evidence based referral criteria for growth monitoring
Arch. Dis. Child., April 1, 2004; 89(4): 336 - 341.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gicquel, C.
Right arrow Articles by Le Bouc, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gicquel, C.
Right arrow Articles by Le Bouc, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals