help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dave-Sharma, S.
Right arrow Articles by New, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dave-Sharma, S.
Right arrow Articles by New, M. I.
The Journal of Clinical Endocrinology & Metabolism Vol. 83, No. 7 2244-2254
Copyright © 1998 by The Endocrine Society


Special Articles

Examination of Genotype and Phenotype Relationships in 14 Patients with Apparent Mineralocorticoid Excess1

Swati Dave-Sharma, Robert C. Wilson, Madeleine D. Harbison, Ron Newfield, Maryam Razzaghy Azar, Zygmunt S. Krozowski, John W. Funder, Cedric H. L. Shackleton, H. Leon Bradlow, Ji-Qing Wei, Jos Hertecant, Antoinette Moran, Richard E. Neiberger, J. Williamson Balfe, Abduhl Fattah, Denis Daneman, H. Ilker Akkurt, Carlo De Santis and Maria I. New

Department of Pediatrics, Division of Pediatric Endocrinology, New York Hospital-Cornell Medical Center, New York, New York 10021

Address all correspondence and requests for reprints to: Maria I. New, M.D., Department of Pediatrics, Division of Pediatric Endocrinology, New York Hospital-Cornell Medical Center, 525 East 68th Street, Room M-420, New York, New York 10021. E-mail: lavander{at}mail.med.cornell.edu


    Abstract
 Top
 Abstract
 Introduction
 Background
 Subjects and Methods
 Results
 Discussion
 References
 
Apparent mineralocorticoid excess (AME) is a genetic disorder causing pre- and postnatal growth failure, juvenile hypertension, hypokalemic metabolic alkalosis, and hyporeninemic hypoaldosteronism due to a deficiency of 11ß-hydroxysteroid dehydrogenase type 2 enzyme activity (11ßHSD2). The 11ßHSD2 enzyme is responsible for the conversion of cortisol to the inactive metabolite cortisone and therefore protects the mineralocorticoid receptors from cortisol intoxication. Several homozygous mutations are associated with this potentially fatal disease. We have examined the phenotype, biochemical features, and genotype of 14 patients with AME.

All of the patients had characteristic signs of a severe 11ßHSD2 defect. Birth weights were significantly lower than those of their unaffected sibs. The patients were short, underweight, and hypertensive for age. Variable damage of one or more organs (kidneys, retina, heart, and central nervous system) was found in all of the patients except one. The follow-up studies of end-organ damage after 2–13 yr of treatment in six patients demonstrated significant improvement in all patients.

The urinary metabolites of cortisol demonstrated an abnormal ratio with predominance of cortisol metabolites, i.e. tetrahydrocortisol plus 5{alpha}-tetrahydrocortisol/tetrahydrocortisone was 6.7–33, whereas the normal ratio is 1.0. Infusion of [11-3H]cortisol resulted in little release of tritiated water, indicating the failure of the conversion of cortisol to cortisone.

Thirteen mutations in the HSD11B2 gene have been previously published, and we report three new genetic mutations in two patients, one of whom was previously unreported. All of the patients had homozygous defects except one, who was a compound heterozygote. Our first case had one of the most severe mutations, resulting in the truncation of the enzyme 11ßHSD2, and died at the age of 16 yr while receiving treatment. Three patients with identical homozygous mutations from different families had varying degrees of severity of clinical and biochemical features. Due to the small number of patients with identical mutations, it is difficult to correlate genotype with phenotype.

In some cases, early and vigilant treatment of AME patients may prevent or improve the morbidity and mortality of end-organ damage such as renal or cardiovascular damage and retinopathy. The outcome of treatment in more patients may establish the efficacy of treatment.


    Introduction
 Top
 Abstract
 Introduction
 Background
 Subjects and Methods
 Results
 Discussion
 References
 
THE FIRST biochemical description of apparent mineralocorticoid excess (AME) in a patient was reported in 1977 (1). To date, there have been approximately 40 AME patients and two 28-week fetuses reported worldwide (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21). The first report of a genetic mutation that caused AME was in 1995 (8); since then, a total of 25 patients have had DNA analysis, which has revealed 13 mutations in the HSD11B2 gene (8, 9, 10, 11, 22, 23, 24). There are very few reports that correlate genotype to phenotype. This is one of the few medical centers in which the same investigators evaluated AME patients clinically as well as biochemically and genetically. Herein we summarize the findings in our 14 patients with AME.


    Background
 Top
 Abstract
 Introduction
 Background
 Subjects and Methods
 Results
 Discussion
 References
 
AME is an autosomal recessive disorder causing a syndrome of juvenile hypertension associated with hypokalemic alkalosis, hyporeninemia, and hypoaldosteronemia due to the defective metabolism of cortisol. The majority of these patients also have hypercalciuria, nephrocalcinosis, and sequelae of hypertension and chronic hypokalemia, such as left ventricular hypertrophy, hypertensive retinopathy, and nephropathy. The disease has been associated with sudden fatality.

The clinical features of AME were first reported by Werder et al. in 1974 (2); in 1977, New et al. described the biochemical features (1, 25) in a 3-yr-old Native American girl from the Zuni tribe. Although this patient had clinical manifestations of hyperaldosteronism, she had very low levels of aldosterone and very low secretion rates of corticosteroids. Several attempts were made to identify an unknown steroid that could act as a mineralocorticoid, but none was found. Later it was shown that there was a deficiency in 11ß-hydroxy-steroid dehydrogenase (11ßHSD) activity (3, 26). It was postulated that the mineralocorticoid specificity of the mineralocorticoid receptor was lost in patients with AME due to a defect in the enzyme 11ßHSD.

Although aldosterone is a more potent mineralocorticoid than cortisol, the mineralocorticoid receptor binds these hormones with equal affinity (27). The type 2 isoform of the 11ßHSD enzyme functions unidirectionally to convert cortisol to cortisone, which does not bind to the mineralocorticoid receptor. Normal subjects are protected from cortisol intoxication by the action of 11ßHSD2. Aldosterone is not metabolized by the 11ßHSD enzyme because it is a ß-lactone, and thus it has unimpeded access to the mineralocorticoid receptor. As cortisol is secreted in milligram amounts whereas aldosterone is secreted in microgram amounts, cortisol saturates the mineralocorticoid receptor in patients with deficient 11ßHSD2 enzyme activity. The resulting inappropriate binding of cortisol to the mineralocorticoid receptor causes sodium retention and volume expansion that suppresses plasma renin and aldosterone secretion and causes potassium excretion and hypokalemia. Signs of mineralocorticoid excess due to cortisol binding to the mineralocorticoid receptor in the absence of aldosterone are the hallmark of the disease.

Although it was initially thought that a mutation in the gene for the hepatic form of the NADP-dependent enzyme 11ßHSD (HSD11B1) was responsible for the disorder, no mutations were found in affected patients (20). Subsequently, a second isoenzyme, 11ßHSD2, which is NAD-dependent, was demonstrated in the rabbit to be active in the kidney (28). The 11ßHSD2 enzyme was found in the renal collecting duct cells and was postulated to be an isoform of the hepatic enzyme that would ensure aldosterone specificity in mineralocorticoid target cells. The complementary DNA (cDNA) and gene for 11ßHSD2 (HSD11B2) were then cloned and mapped to human chromosome 16q22 (10, 29). Immunohistological studies localized the type 2 isoform to the distal nephron of the human kidney (30, 31, 32).

In 1995, the first genetic mutation (R337C) in the HSD11B2 gene was detected in a family from Iran with three AME-affected children (8). Thirteen specific mutations in the HSD11B2 gene have been reported to date (8, 9, 10, 11, 22, 23, 24). Herein we report three previously unpublished mutations in two patients with AME. In our patients, the various mutations all occur in the coding region of HSD11B2. However, Mune et al. reported one mutation in intron 3 outside the coding region (10). The mutations significantly decrease enzymatic activity, as recent in vitro expression studies have shown (10, 22, 33, 34). Mutations were introduced into HSD11B2 cDNA, subcloned, and transfected into CHOP cells, and the transfectants were then tested for their ability to convert physiological concentrations of cortisol to cortisone, or corticosterone to 11-dehydrocorticosterone. It was shown that the mutants expressed no activity or greatly reduced enzymatic activity compared to the wild types.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Background
 Subjects and Methods
 Results
 Discussion
 References
 
All of the patients with AME in this report have been evaluated clinically, biochemically, and genetically at the Children’s Clinical Research Center of The New York Hospital-Cornell Medical Center (NYH-CMC), except for patients H-1, H-2, and H-5 (1, 3, 9, 35). Patients H-1, H-2, and H-5 are sibs in a family living in remote Iran (8). Their pediatric endocrinologist (author M.R.) in Iran evaluated the patients personally and brought samples to our laboratory.

All of the patients had characteristic signs of a severe 11ßHSD2 defect, i.e. low birth weight, failure to thrive, poor growth, marked hypokalemia, significant low renin hypertension, low to absent secretion of adrenal steroids, and markedly impaired capacity to convert cortisol to cortisone. The referring physicians have provided records of previous care, and in all cases the diagnosis was made or confirmed at NYH-CMC at the Children’s Clinical Research Center (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. AME signs and biochemical features at presentation

 
Families previously reported

Twelve of the 14 patients and their families have been previously described (Fig. 1Go) (1, 8, 9).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 1. Family pedigrees of eight previously reported families [families A–G (9 ) and H (8 )]. Family pedigrees of two families (I and J) are reported for the first time. The arrow indicates the proband. As family E was reported, the father of E-1 was genotyped and was found to be homozygous normal; paternity is uncertain.

 
Families not previously fully described

Patient I-1 Patient I-1 was briefly reported in (20) but was not hormonally or genetically evaluated. Patient I-1 is an Italian-Moroccan male, a product of a nonconsanguineous marriage (Fig. 1Go). His birth weight was 2.25 kg at 40 weeks gestation. Birth was by spontaneous vaginal delivery. At 1 month of age he was noted to have polyuria and polydipsia. Hypertension (blood pressure, 160/110 mm Hg) was first noticed at the age of 4 yr. He underwent an endocrinological evaluation, which revealed low renin hypertension. At age 10 yr, AME was diagnosed, which was confirmed at NYH-CMC at the age of 10.5 yr. On examination at NYH-CMC, he was a prepubertal male with a height of 132.7 cm (height z-score, -1.26 SD) and a weight of 29.2 kg (weight, z-score, -0.58 SD). His baseline blood pressure was 140–180/90–100 mm Hg (90th percentile for age is 115/73). Fundoscopic examination revealed grade I hypertensive retinopathy. The initial laboratory serum values were as follows: potassium, 2.6 mmol/L; sodium, 139 mmol/L; CO2, 31 mmol/L; blood urea nitrogen, 8 mmol/L; and creatinine, 0.5 mg/dL. PRA was markedly suppressed (0.08 ng/mL·h). Serum and urinary aldosterone and serum deoxycorticosterone were undetectable by RIA. The chest x-ray revealed mild cardiomegaly and fullness in the ascending aorta, and an electrocardiogram demonstrated left ventricular hypertrophy. Urine analysis was significant for alkaline pH (7.5–8) and for hypercalciuria and triple phosphate crystals. Creatinine clearance ranged from 78–180 mL/min·1.73 m2. Nephrocalcinosis in the renal pyramids was observed on renal sonography. Bone age was appropriate for chronological age. The results of his endocrine evaluation at NYH-CMC are shown in Tables 2–4GoGoGo. He was treated with spironolactone (100 mg, twice daily), which was raised to 150 mg, twice daily. Thiazide diuretic and potassium supplementation were added for better control of serum electrolytes and blood pressure. The results of follow-up studies are shown in Table 5Go.


View this table:
[in this window]
[in a new window]
 
Table 2. AME signs and biochemical features evaluated at the New York Hospital-Cornell Medical Center’s Children’s Clinical Research Center

 

View this table:
[in this window]
[in a new window]
 
Table 3. Serum steroid concentrations and PRA evaluated at the New York Hospital

 

View this table:
[in this window]
[in a new window]
 
Table 4. Complications (end-organ damage) in AME patients

 

View this table:
[in this window]
[in a new window]
 
Table 5. Follow-up of end-organ damage after treatment in AME patients

 
Patient J-3. Patient J-3 is a 3-yr-old Turkish male from Germany. Although consanguinity was denied, the parents came from the same small village in Turkey (Fig. 1Go). He was born at full term with a birth weight of 2.5 kg. He was diagnosed with left-sided ptosis at birth. He presented at 4 weeks of age with persistent vomiting and hypokalemic alkalosis. Hypertropic pyloric stenosis was suspected. Pyloromyotomy was postponed because of persistent hypokalemia despite iv potassium supplementation. Adenoidectomy was performed at 1.8 yr of age because of recurrent infection of the upper airways. Hypertension was noted, with blood pressure values of 137–152/78–93 mm Hg (90th percentile for age is 106/68), and the serum potassium concentration was 3.0 mmol/L (normal, 4.5 mmol/L). Because of persistent infection of the upper airways, readenoidectomy was planned; his serum potassium concentration (on preoperative routine examination) was 1.8 mmol/L. The patient was then referred to an endocrinologist at the Children’s Hospital of Hamburg, Germany, where he was diagnosed with AME. Dexamethasone (0.25 mg/day) was administered, and the dose was increased to 0.5 mg/day with potassium supplementation. No improvement in hypertension was noticed. The patient was then referred to us at NYH-CMC at 3.2 yr of age. The treatment was discontinued for 10 days before his arrival. Blood pressure at NYH-CMC was elevated for age (143/86 mm Hg; 90th percentile, 99/60), height z-score was -1.73 (88.6 cm), and weight z-score was -1. 6 (12.2 kg). The fundoscopic examination did not reveal hypertensive retinopathy, and the electrocardiogram, echocardiogram, magnetic resonance imaging of the brain, and electroencephalogram were normal. A sonogram of the kidneys revealed bilateral nephrocalcinosis. The diagnosis of AME was then established biochemically and was later confirmed genetically. The results of his endocrine evaluation at NYH-CMC are shown in Tables 2–4GoGoGo. The patient’s hypertension responded to spironolactone (50 mg, twice daily) and hydrochlorothiazide (12.5 mg, twice daily).

Laboratory methods and procedures

The patients were studied under an institutionally approved protocol at the Children’s Clinical Research Center of NYH-CMC. Blood pressures were measured every 2 h with a mercury sphygmomanometer after the patient had been supine for at least 10 min throughout their hospitalization. Patients were given diets calculated for calories, sodium, and potassium by the Children’s Clinical Research Center kitchen. Their 24-h urine samples were collected and checked for urinary steroids, sodium, potassium, calcium, and creatinine. Blood samples for adrenal steroid, PRA, and electrolyte determinations were collected daily at 0800 h. The results for blood pressure, electrolytes, and steroids were reported at baseline phase while patients were receiving a normal sodium diet and without medication.

Hormone analysis

Serum cortisol, aldosterone, deoxycorticosterone, and corticosterone were measured according to previously reported methods (36, 37, 38, 39, 40, 41). PRA was measured by the method of Sealey et al. (42). Urinary steroid metabolites were measured by assays described by Shackleton et al. (43).

Cortisol studies

To determine cortisol secretion rates and cortisol half-life, we followed the previously described protocols (1, 3, 35).

To establish the dysfunction of the 11ßHSD2 enzyme, the metabolism of cortisol to cortisone was determined by measuring the release of tritiated water after [11-3H]cortisol infusion. [3H]Cortisol infusion was performed according to the method reported by Hellman et al. (44). Tritiated water was recovered from the plasma by lyophilization.

DNA analysis

DNA sequencing was carried out after two rounds of PCR. In the first PCR, 100–500 ng genomic DNA (obtained from peripheral blood leukocytes) as previously described (45) were denatured for 10 min at 98 C and amplified using primers 54 GTGACTCTGGTTTTGGCAAGGA and 58 AAGTACAGTACATGCTTCCCTGTGG. The following reagents were added to the denatured DNA: 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 1.5 mmol/L MgCl2, 0.01% gelatin, 0.75 U Taq (Life Technologies, Grand Island, NY) polymerase, 200 µmol/L deoxy-NTP, and 0.3 µmol/L of each primer. The samples were subjected to denaturation at 94 C for 2 min. Five cycles, consisting of 94 C for 1 min, 60 C for 1.5 min, and 72 C for 10 min, were performed, followed by 30 cycles, consisting of 94 C for 1 min, 60 C for 1.5 min, and 72 C for 4 min. A final cycle consisted of 94 C for 1 min, 60 C for 1.5 min, and 72 C for 10 min.

The second PCR was performed in a 50-µL reaction containing 2 µL from the first PCR, with 15 pmol forward primer and 5 pmol reverse biotin primer (see Table 6Go). The remaining reagents were identical to those of the first PCR. The samples were denatured for 1 min at 95 C, followed by 4 cycles of 1 min at 95 C, 30 s at 58 C, and 10 min at 72 C; followed by 30 cycles of 30 s at 95 C, 30 s at 58 C, and 1 min at 72 C; followed by 1 cycle of 1 min at 95 C, 1.5 min at 58 C, and 10 min at 72 C.


View this table:
[in this window]
[in a new window]
 
Table 6. Sequencing primers

 
The 5'-end of exon 2 was PCR amplified directly without the first round of PCR, using 100–500 ng genomic DNA using the same conditions as those for the second PCR.

DNA sequencing

Sequencing of the HSD11B2 gene was performed using solid phase single strand sequencing with the Sequenase Dye Primer Kit (Applied Biosystems, Foster City, CA) containing M13 primers. Single stranded DNA from the PCR fragments were purified with streptavidin-bound magnetic beads (Dynal, Oslo, Norway), following the procedure in Bulletin 21 from Applied Biosystems. After denaturation to remove the nonbiotinylated DNA strand, the bound DNA strand was sequenced. Sequencing was performed according to the procedure described in the sequencing manual supplied with the sequencing kit. The sequencing products were electrophoresed and analyzed with an Applied Biosystems model 373A sequencer.

Expression studies

In vitro expression studies using cDNAs with the mutations found in the HSD11B2 gene of patients A-1, D-1, D-2, and F-2 were performed as described previously (34) and with the mutations found in patients H-1, H-2 and H-5 as described previously (33). In vitro expression studies, using a different expression system in patients B-1, C-1, E-1, G-5, and G-6, were reported by Mune et al. (10).


    Results
 Top
 Abstract
 Introduction
 Background
 Subjects and Methods
 Results
 Discussion
 References
 
Signs and biochemical features at presentation

The features of our AME patients at first presentation to their primary or referring physicians are presented in Table 1Go. The patients were of varied ethnic ancestry. Ages ranged from 1–14 yr, and the male to female ratio was 9:5. All of the patients were born with low birth weight compared to unaffected sibs (Table 7Go). The gestational age for patients A-1, C-1, and F-2 was 36 weeks; the gestational age of the rest of the patients was 39–40 weeks (Table 7Go). All of the patients demonstrated failure to thrive in their early childhood. The majority of our patients had polyuria and polydipsia as a consistent presenting feature in early childhood due to nephrogenic diabetes insipidus secondary to hypokalemic nephropathy. The height z-score for our patients ranged from -4.2 to -0.6 (with the one exception of patient D-2, whose height z-score was 0.33), and the weight z-score ranged from -3.9 to -0.6. All of the patients had significant hypertension compared to the 90th percentile for normal age- and sex-matched children. Hypokalemic alkalosis was observed in all of the patients.


View this table:
[in this window]
[in a new window]
 
Table 7. Birth weights of AME patients relative to sib birth weights

 
Signs and biochemical features evaluated at NYH-CMC

Before the arrival and evaluation of our AME patients at NYH-CMC, either patients had never been treated with spironolactone (patients A-1, D-1, D-2, G-5, G-6, and J-3), or spironolactone was discontinued for variable periods of time (10 days to 3 months). The clinical signs and biochemical features on their admission to NYH-CMC are presented in Table 2Go. All patients had severe hypertension and hypokalemic alkalosis. Cortisol secretion rates were measured in 10 patients. All of the patients tested had very low rates, ranging from 0.05–0.83 mg/day, compared to the normal secretion rate of 5–25 mg/day. We studied the cortisol half-life in 5 patients, all of whom had a longer than normal result (ranging from 113–187 min, compared to the normal value of 80 min). Eight patients were tested for the conversion of cortisol to cortisone. Of those, none could convert more than 6% of cortisol to cortisone, compared to 90–95% conversion in the normal population. The tetrahydrocortisol (THF) plus 5{alpha}THF/tetrahydrocortisone (THE) ratio, representing the major urinary metabolites of cortisol (THF) and cortisone (THE), was significantly elevated in all of the patients. In patient B-1, the THF/THE ratio was tested instead, which was 9 (normal, <=1). Thirteen patients were found to have a homozygous mutation for the HSD11B2 gene. One patient (I-1) was a compound heterozygote (Fig. 1Go).

Molecular analysis

Nine specific mutations in the HSD11B2 gene have been identified in our patients (Fig. 2Go, Table 2Go). Mutations in patients A–H were previously described (8, 9). Sequence analysis of the HSD11B2 gene in patients I and J are reported for the first time. Patient I-1 carries a novel heterozygous T to G transversion in the second nucleotide of codon 250, resulting in a substitution of the leucine with an arginine (L250R) inherited from his father, and he carries a novel heterozygous G to A transition in the first nucleotide of codon 244, resulting in a substitution of an aspartic acid with an asparagine (D244N) inherited from his mother (Fig. 1Go). Patient J-3 carries a novel homozygous 1-base deletion (N286 -1 frame shift) of a C nucleotide, either in the third nucleotide of codon 286 (AAC) or in the first nucleotide of codon 287 (CTG), resulting in a truncated and missense N-terminus of 11ßHSD2. Both the mother and the father were heterozygous for this deletion, and the unaffected sib was homozygous normal (Fig. 1Go).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 2. Mutations in the gene for 11ßHSD type 2 in families affected with AME. The HSD11B2 gene has five exons, is 6.2 kb long, and has been mapped to chromosome 16q22. Mutations in families A–G (9 ) and H (8 ) have been reported previously. Mutations in families I and J are reported here for the first time (shaded boxes). All mutations found in affected patients are homozygous, except in patient I-1, who is compound heterozygous. het, Heterozygous.

 
In vitro expressions

In vitro expression studies using mutations found in patients A–H revealed no conversion of cortisol to cortisone, with the exception of the mutation found in patients G-5 and G-6, which showed 7% conversion (Table 2Go) (10, 33, 34). As these patients were clinically symptomatic, 7% activity may not be enough for normal cortisol metabolism.

In vitro expression studies were not performed for patients I-1 and J-3. Krozowski and colleagues were able to assign functional domains to 11ßHSD2 by comparing its amino acid sequence to other short chain alcohol dehydrogenases (46, 47, 48). The D244N mutation found in patient I-1 falls within the D domain, which is presumed to be the active site. Using the algorithm developed by Chou and Fasman (49, 50, 51, 52), the predicted secondary structure from the D244N mutation compared to the normal 11ßHSD2 enzyme would result in truncation of the helix structure that is formed in the D domain. The analysis by Chou and Fasman of the L250R mutation found on patient I-1’s other HSD11B2 allele suggests that this results in an introduction of turns between the D and E domains. The analysis by Chou and Fasman of the L250P, L251S mutation, which is known to be responsible for absent in vitro 11ßHSD2 activity and when homozygous results in AME (9, 10, 34), suggests the same introduction of turn structures between the D and E domains. Thus, the compound heterozygous D244N and L250R mutations found in patient I-1 most likely result in diminution of enzymatic activity. The homozygous deletion of the C nucleotide in patient J-3 results in termination at codon 322 instead of 405, with missense amino acids from codon 287 to codon 322. The N286 -1 frame shift found in patient J-3 should be equal to or more deleterious than the mutation in patient A-1 (E356 -1 frame shift), which results in termination at codon 395 and showed no conversion of cortisol to cortisone in expression studies (34).

Steroid levels and PRA evaluated at NYH-CMC

The hormone levels in the patients newly described herein conform to those found in the patients previously reported (Table 3Go). All serum steroid levels were low, except for deoxycorticosterone and cortisol, which ranged from undetectable to normal levels. The normal serum concentration of cortisol despite a low secretion rate is probably owed to its long half-life (Table 2Go).

Complications (end-organ damage)

End-organ damage was observed frequently in our AME patients (Table 4Go). The urinary calcium/creatinine ratio was established for the patients after treatment was discontinued, with the exception of patients H-1, H-2, and H-5, who remained on spironolactone. Seven of 12 (58.3%) patients had hypercalciuria, with a ratio ranging from 0.23–0.73 (normal calcium to creatinine ratio, <0.2). Nephrocalcinosis was found in 8 of 14 (57.1%) patients, including patient B-1, whose urinary calcium to creatinine ratio was normal. Patient H-1 did not have nephrocalcinosis, although her kidneys had decreased in size, and her serum creatinine concentration was high. Hypertensive retinopathy was reported by ophthalmologists in 10 of 14 (71.4%) patients. A cardiac evaluation gave evidence of left ventricular hypertrophy by electrocardiogram and/or echocardiogram in 11 of the 14 (78.6%) patients. A history of developmental delay was reported by a primary care physician in 4 patients. A history of transient or permanent neurological defects was found in 8 of 14 (57.1%) of the patients. Electroencephalographic examination revealed 5 of 10 (50%) patients to have a pattern consistent with generalized seizure disorder or generalized cerebral dysfunction, although none had confirmed clinical seizures. The parents of patient F-2 reported that he had momentary blank stares and lapses of awareness from seconds to minutes at a time (with no history of clonic jerks), suggestive of absence seizures. Three of 9 (33.3%) patients who had magnetic resonance imaging of the brain had a morphological abnormality. Patient B-1 had infarct in the internal capsule of the brain, patient E-1 had left cerebellar infarct, and patient G-5 had a nonspecific finding of a small arachnoid cyst in the brain.

Response to administration of hydrocortisone and spironolactone

We studied the effects of hydrocortisone and spironolactone administration in AME patients previously (26). Herein we report the results of two additional patients studied. After stabilizing the patients with the optimum dose of spironolactone (300 mg/day) that controlled their blood pressure and serum electrolytes, hydrocortisone (2 mg/day, 4 times their endogenous secretion rate) was administered for 3 days, followed by 10 mg/day for 3 days. In both patients, mineralocorticoid blockade was overcome (Table 8Go) with doses of hydrocortisone simulating stress, as shown by the decrease in serum K+, suppression of PRA, and gradual and significant rise in mean 24-h blood pressure.


View this table:
[in this window]
[in a new window]
 
Table 8. Response to administration of hydrocortisone and spironolactone

 
Mineral balance studies

Sodium balance in five patients have been previously reported (1, 3, 35). Six additional patients were studied in a protocol in which a low salt diet containing 10 mEq sodium was administered. All six patients (E-1, F-2, G-5, G-6, I-1, and J-3) retained sodium and lowered the urinary excretion of sodium to less than 10 mEq/day. Serum potassium rose, and the blood pressure fell. Further, all five patients responded to spironolactone administration by lowering their blood pressure, raising serum potassium, and slowly increasing PRA and serum aldosterone levels. When hydrochlorothiazide was added to the spironolactone administration, the blood pressure fell to normal. In four of the five patients, ACTH was administered and caused a rise in blood pressure and a fall in serum potassium. These studies were similar to those performed on the previously reported patients.

Follow-up of end-organ damage after treatment

Six patients were reevaluated 2–10 yr after their initial diagnosis at NYH-CMC. The change in end-organ damage is reported in Table 5Go. The treatment of all of those patients consisted of spironolactone (dose range, 2–12.5 mg/kg·day), hydrochlorothiazide (dose range, 0.2–3 mg/kg·day), and potassium supplement in some, as required. The heights of four of six patients showed variable improvement with treatment. Although the height z-score of patient I-1 did not improve, it is still consistent with his target height z-score.

Body mass index improved compared to the pretreatment value. Hypercalciuria improved in all of the patients. Sonographic evidence of nephrocalcinosis resolved in three of four patients. Pretreatment cardiac damage in the form of left ventricular hypertrophy was present in all six patients. The follow-up echocardiographic studies showed the absence of left ventricular hypertrophy in four patients and improvement in the other two patients. Hypertensive retinopathy was reversed after treatment in five patients and improved in one.

The follow-up of the clinical status of the majority of our other patients was reported by personal communication with local physicians. As we have previously mentioned, patient A-1 died suddenly at the age of 16 yr while being treated with spironolactone and thiazide diuretic. Patient B-1 may be the oldest survivor with this disease. He is 35 yr old, married, and working in Australia. His blood pressure is intermittently elevated, for which he is receiving spironolactone therapy along with other antihypertensive drugs (Enalapril, Amiloride, and Persantin). Bilateral nephrocalcinosis persists with normal serum creatinine and mild hypertensive retinopathy. At 30 yr of age he was diagnosed with an aortic aneurysm that involved the aortic root and aortic valve, which was treated with valve replacement surgery. A current electrocardiogram showed high QRS voltages and T-wave changes, with multiple ventricular extrasystoles. Patients D-1 and D-2 were lost for follow-up; according to their mother, they continue to be hypertensive. Their final height is 60 in. (target height is 66 in.). Patient H-1 had delayed puberty, as menarche occurred at 16 yr of age. She has severe hypertensive retinopathy, evident by the presence of hemorrhages and exudates in the retina. She has genu valgum associated with low serum calcium concentration, and high alkaline phosphatase and PTH levels. Her kidneys are severely damaged, with renal insufficiency evident from high serum creatinine levels. Patient H-2’s hypertensive retinopathy is improved, and he is in good health. Patient H-5 is in good health without any signs of end-organ damage.


    Discussion
 Top
 Abstract
 Introduction
 Background
 Subjects and Methods
 Results
 Discussion
 References
 
As evidenced by the data herein, patients with AME present with a characteristic phenotype. Hypertension, hypokalemic alkalosis, hyporeninemia, hypoaldosteronemia, and the defective metabolism of cortisol to cortisone are consistent clinical and biochemical manifestations. Low birth weight and subsequent failure to thrive are also consistent features of our patients (11).

A deficiency of 11ßHSD2 in the fetus may lead to intrauterine growth retardation and low birth weight, as evidenced by the low birth weight of AME patients compared to the normal birth weights of unaffected sibs. These data do not suggest a maternal or environmental cause of low birth weights in our patients, because if this was the cause, the birth weights of the sibs would be similarly affected.

The human placenta is reported to have abundant type 2 isoform (NAD-dependent) of 11ßHSD (53, 54). Benediktsson et al. reported that placental 11ßHSD2 actively converts cortisol to cortisone (55). It has been reported that there is a positive correlation between normal placental 11ßHSD type 2 activity and birth weight (56). We have shown that in patients affected with 11ßHSD2 deficiency, birth weight is low. This has been attributed to a deficiency of placental 11ßHSD2 (57, 58). However, this hypothesis requires further investigation.

As has been described, families with AME demonstrate consanguinity or endogamy (8, 9). For example, patient A-1 belongs to the Parrot Clan of the Zuni tribe, which resides on a restricted reservation in New Mexico. Both parents are members of the Parrot Clan. The parents in family G are from a tribe of about 10,000 people called the Mozaini Tribe in which consanguinity and tribal inbreeding are the custom. Both of the closed societies in families A and G appear to have knowledge of the effects of endogamy and have tried to develop methods to avoid its negative genetic consequences. Consanguinity is also present in families F and H. Family F is Native American of the Chippewa Tribe; as evidenced in the pedigree, the mother’s grandparents are the father’s maternal grandparents. Family H comes from rural Iran near Hamedan; the parents are first cousins. Family B is Zoroastrian from Iran, and families C and E come from the area of India to which Zoroastrians emigrated. Although families C and E claim to be Hindu, it is possible that they have a common Zoroastrian ancestor and have identity by descent. Family D is African-American, and although consanguinity is denied, it should be noted that the African-American population was restricted in its marital practices when it first arrived in the United States.

In families J and I, we have no verification of consanguinity. Family J is a religious Muslim family, all of whom originated from the same village in Turkey. Although there is no confirmed history of consanguinity in patient J-3’s parents, relatives of family J report that there was consanguinity two or more generations previously. As both parents are heterozygous for the same mutation, consanguinity is possible. As family I is clearly nonconsanguineous, it is not surprising that the patient is a compound heterozygote. However, the compound heterozygosity did not result in a mild form of the disease, suggesting the absence of genetic complementarity.

It is difficult to make phenotypic correlations with the genotypes we have identified among our patients due to the small number of patients with identical mutations. In an attempt to examine two patients with highly similar mutations, we have compared patients A-1 and J-3 to each other, as their mutations both result in truncations of 11ßHSD2. Patient J-3’s mutation would be expected to be at least equal to or more severe than that of patient A-1 because the truncation is more premature. Yet, patient A-1 had more severe complications in the form of her clinical presentation, such as lower birth weight, greater failure to thrive, more severe hypertension, and presence of left ventricular hypertrophy, and in her biochemical presentation, such as a higher THF plus 5{alpha}THF/THE ratio and absent cortisol to cortisone conversion compared to those of patient J-3. Patient A-1 died suddenly at age 16 yr of unclear cause despite being treated for her disease. The fact that this patient died and also has one of the most severe mutations molecularly suggests a relationship of genotype to phenotype. For this reason, patient J-3 must be monitored carefully to ensure that his disease is controlled, as he is much younger than when A-1 died, and his genotypic similarity may put him at risk for severe complications.

Patients B-1, C-1, and E-1 carry the same homozygous mutation. However, these patients have varying degrees of severity in clinical and biochemical features. An examination of many parameters reveals little consistency; birth weight, failure to thrive, hypertension, nephrocalcinosis, left ventricular hypertrophy, neurological damage, THF plus 5{alpha}THF/THE ratio, and defects in cortisol to cortisone conversion ranged from mild to severe in all three patients.

Patients D-1 and D-2 have the same mutation, and clinical and biochemical aspects were similar. Genotype also correlates with phenotype in patients G-5 and G-6, and among sibs H-1, H-2, and H-5. However, patients D-1 and H-1 showed greater severity of their disease than their sibs, although this could be attributed to their later diagnosis and later treatment initiation than their younger sibs.

Severe hypertension and hypokalemic alkalosis are associated with end-organ damage in AME patients, particularly of the retina, kidney, and cardiovascular and central nervous systems. Cardiac damage is manifested mainly in the form of concentric left ventricular hypertrophy with increased left ventricular mass. Kidney manifestations are seen in the form of hypercalciuria, nephrocalcinosis, and in some cases renal insufficiency. Hypertensive retinopathy is consistently found in all patients, ranging from mild to moderate grades. The presence of abnormal findings in electroencephalogram studies, performed after normalizing serum electrolytes, is suggestive of central nervous system dysfunction and seizure disorder; the absence of seizures requires further explanation. This is a particularly important observation in light of the emerging central nervous system roles for mineralocorticoids (59, 60, 61).

The follow-up studies of complications in AME patients are reported in Table 5Go. We treated our AME patients with spironolactone, a mineralocorticoid receptor blocker, and demonstrated improvements in their clinical symptoms. The dose range of spironolactone was wide (2–10 mg/kg·day). The spironolactone was started at a very low dose and was gradually increased until the desired blood pressure response and serum potassium concentration were achieved. As hypercalciuria and nephrocalcinosis are consistent features of this disease, thiazide diuretic was added in most of our patients’ treatment regimens. The reversal of bilateral nephrocalcinosis of the kidneys in our patients is evidence of the success of treatment. Thiazide diuretics also aid in lowering blood pressure and in some patients may allow for the dose of spironolactone to be reduced. This is particularly important in patients manifesting antiandrogenic side-effects (e.g. gynecomastia) of spironolactone. The improved growth and the reversal of hypertensive retinopathy and left ventricular hypertrophy further demonstrate that proper treatment and meticulous compliance are able to control this severe and sometimes fatal disease.

We have reported that hydrocortisone administration raised the blood pressure and lowered the serum potassium concentration in all patients with AME (1, 26, 35). In two additional patients we studied, patients G-5 and G-6, hydrocortisone administration increased the mean 24-h blood pressure and lowered the serum potassium level significantly despite the administration of spironolactone treatment. This suggests the possibility that routine doses of spironolactone, although high, may be inadequate to accommodate high endogenous cortisol secreted during stressful periods of life.

The diagnosis of AME should be suspected in patients with the features of low birth weight, failure to thrive, polyuria/polydipsia, and hypertension. The baseline evaluation should include biochemical evidence of hypokalemic alkalosis, hyporeninemia, and hypoaldosteronemia, which are typical biochemical features of AME. If PRA and aldosterone are suppressed; the diagnosis of 11ß-hydroxylase deficiency, 17{alpha}-hydroxylase deficiency, or a deoxycorticosterone-producing tumor has been excluded; and excess licorice ingestion is denied, a 24-h urine test for cortisol metabolites should be performed and analyzed for the ratio of THF plus 5{alpha}THF/THE. The ideal biochemical diagnostic procedure involves testing for the conversion of [3H]cortisol to [3H]cortisone by measuring 3H2O release after injecting [11-3H]cortisol; however, this test is technically difficult and not widely available. DNA analysis will confirm the diagnosis upon identification of a homozygous or compound heterozygous mutation in the HSD11B2 gene and should be used as a tool in genetic counseling for the affected families.

In some cases, early and vigilant treatment of AME patients may prevent or improve the morbidity and mortality of end-organ damage, such as renal or cardiovascular damage and retinopathy. The outcome of treatment studied in more patients may establish efficacy of treatment.

In the past, it was believed that receptors determined the specificity of hormone action. In this respect, AME has opened up a new field of receptor biology by demonstrating that receptors can be promiscuous with respect to ligands. The specificity of the mineralocorticoid receptor depends on the 11ßHSD enzyme.


    Acknowledgments
 
The authors express their sincere appreciation to the following people: Laurie Vandermolen, for editorial assistance; Jihad Obeid, for data analysis and consultation; Tatiana Pechtchanskaia, for database assistance; Dr. Frank Alfred, for clinical patient data; Martin Lesser, for biostatistical analysis; Teresa Licholai, for laboratory analysis; the Children’s Clinical Research Center nurses and other staff, for their support and dedication; and the patients and their parents, for their participation and patience during the long periods of study.


    Footnotes
 
1 Significant sections of the work for which the data are reported herein were supported by USPHS Grant HD-00072 and General Clinical Research Center Grant RR-06020. Transportation for the patients and their families was made possible by the Mary T. Harriman Fund. Back

Received February 9, 1998.

Accepted April 14, 1998.


    References
 Top
 Abstract
 Introduction
 Background
 Subjects and Methods
 Results
 Discussion
 References
 

  1. New MI, Levine LS, Biglieri EG, Pareira J, Ulick S. 1977 Evidence for an unidentified steroid in a child with apparent mineralocorticoid hypertension. J Clin Endocrinol Metab. 44:924–933.[Abstract]
  2. Werder EA, Zachmann M, Vollmin JA, Veyrat R, Prader A. 1974 Unusual steroid excretion in a child with low-renin hypertension. Res Steroids. 6:385–389.
  3. Ulick S, Levine LS, Gunczler P, et al. 1979 A syndrome of apparent mineralocorticoid excess associated with defects in the peripheral metabolism of cortisol. J Clin Endocrinol Metab. 49:757–764.[Abstract]
  4. Shackleton CH, Rodriguez J, Arteaga E, Lopez JM, Winter JS. 1985 Congenital 11 beta-hydroxysteroid dehydrogenase deficiency associated with juvenile hypertension: corticosteroid metabolite profiles of four patients and their families. Clin Endocrinol (Oxf). 22:701–712.[Medline]
  5. Stewart PM, Corrie JE, Shackleton CH, Edwards CR. 1988 Syndrome of apparent mineralocorticoid excess. A defect in the cortisol-cortisone shuttle. J Clin Invest. 82:340–349.
  6. Batista MC, Mendonca BB, Kater CE, et al. 1986 Spironolactone-reversible rickets associated with 11 beta-hydroxysteroid dehydrogenase deficiency syndrome. J Pediatr. 109:989–993.[CrossRef][Medline]
  7. Monder C, Shackleton CH, Bradlow HL, et al. 1986 The syndrome of apparent mineralocorticoid excess: its association with 11ß-dehydrogenase and 5ß-reductase deficiency and some consequences for corticosteroid metabolism. J Clin Endocrinol Metab. 63:550–557.[Abstract]
  8. Wilson RC, Krozowski ZS, Li K, et al. 1995 A mutation in the HSD11B2 gene in a family with apparent mineralocorticoid excess. J Clin Endocrinol Metab. 80:2263–2266.[Abstract]
  9. Wilson RC, Harbison MD, Krozowski ZS, et al. 1995 Several homozygous mutations in the gene for 11ß-hydroxysteroid dehydrogenase type 2 in patients with apparent mineralocorticoid excess. J Clin Endocrinol Metab. 80:3145–3150.[Abstract]
  10. Mune T, Rogerson FM, Nikkila H, Agarwal AK, White PC. 1995 Human hypertension caused by mutations in the kidney isozyme of 11ß-hydroxysteroid dehydrogenase. Nat Genet. 10:394–399.[CrossRef][Medline]
  11. Kitanaka S, Tanae A, Hibi I. 1996 Apparent mineralocorticoid excess due to 11ß-hydroxysteroid dehydrogenase deficiency: a possible cause of intrauterine growth retardation. Clin Endocrinol (Oxf). 44:353–359.[CrossRef][Medline]
  12. Sann L, Revol A, Zachmann M, Legrand JC, Bethenod M. 1976 Unusual low plasma renin hypertension in a child. J Clin Endocrinol Metab. 43:265–271.[Abstract]
  13. Shackleton CH, Honour JW, Dillon MJ, Chantler C, Jones RW. 1980 Hypertension in a four-year-old child: gas chromatographic and mass spectrometric evidence for deficient hepatic metabolism of steroids. J Clin Endocrinol Metab. 50:786–802.[Abstract]
  14. Honour JW, Dillon MJ, Levin M, Shah V. 1983 Fatal, low renin hypertension associated with a disturbance of cortisol metabolism. Arch Dis Child. 58:1018–1020.[Abstract]
  15. Milford DV, Shackleton CHL, Stewart PM. 1995 Mineralocorticoid hypertension and congenital deficiency of 11ß-hydroxysteroid dehydrogenase in a family with the syndrome of ‘apparent’ mineralocorticoid excess. Clin Endocrinol (Oxf). 43:241–246.[Medline]
  16. Muller-Berghaus J, Homoki J, Michalk DV, Querfeld U. 1996 Diagnosis and treatment of a child with the syndrome of apparent mineralocorticoid excess type 1. Acta Paediatr. 85:111–113.[Medline]
  17. Fiselier TJ, Otten BJ, Monnens LA, Honour JW, van Munster PJ. 1982 Low-renin, low-aldosterone hypertension and abnormal cortisol metabolism in a 19-month-old child. Horm Res. 16:107–114.[Medline]
  18. Harinck HI, van Brummelen P, Van Seters AP, Moolenaar AJ. 1984 Apparent mineralocorticoid excess and deficient 11 beta-oxidation of cortisol in a young female. Clin Endocrinol (Oxf). 21:505–514.[Medline]
  19. Winter JSD, McKenzie JK. 1977 A syndrome of low-renin hypertension in children. In: New MI, Levine S, eds. Juvenile hypertension. New York: Raven Press; 123–132.
  20. Nikkila H, Tannin GM, New MI, et al. 1993 Defects in the HSD11 gene encoding 11 beta-hydroxysteroid dehydrogenase are not found in patients with apparent mineralocorticoid excess or 11-oxoreductase deficiency. J Clin Endocrinol Metab. 77:687–691.[Abstract]
  21. Gourmelen M, Saint-Jacques I, Morineau G, Soliman H, Julien R, Fiet J. 1996 11ß-Hydroxysteroid dehydrogenase deficit: a rare cause of arterial hypertension. Diagnosis and therapeutic approach in two young brothers. Eur J Endocrinol. 135:238–244.[Abstract/Free Full Text]
  22. Stewart PM, Krozowski ZS, Gupta A, Milford DV, Howie JA, Sheppard MC. 1996 Hypertension in the syndrome of apparent mineralocorticoid excess due to mutation of the 11ß-hydroxysteroid dehydorgenase type 2 gene. Lancet. 347:88–91.[CrossRef][Medline]
  23. Kitanaka S, Katsumata N, Tanae A, et al. 1997 A new compound heterozygous mutation in the 11ß-hydroxysteroid dehydrogenase type 2 gene in a case of apparent mineralocorticoid excess. J Clin Endocrinol Metab. 82:4054–4058.[Abstract/Free Full Text]
  24. Li S, Li KXZ, Marui S, et al. 1997 Apparent mineralocorticoid excess in a Brazilian kindred: hypertension in the heterozygote state. J Hypertens. 15:1397–1402.[CrossRef][Medline]
  25. Ulick S, Ramirez LC, New MI. 1977 An abnormality in steroid reductive metabolism in a hypertensive syndrome. J Clin Endocrinol Metab. 44:799–802.[Abstract]
  26. Oberfield SE, Levine LS, Carey RM, Greig F, Ulick S, New MI. 1983 Metabolic and blood pressure responses to hydrocortisone in the syndrome of apparent mineralocorticoid excess. J Clin Endocrinol Metab. 56:332–339.[Abstract]
  27. Lan NC, Matulich DT, Stockigt JR, et al. 1980 Radioreceptor assay of plasma mineralocorticoid activity. Role of aldosterone, cortisol, and deoxycorticosterone in various mineralocorticoid-excess states. Circ Res. 46:I94–I100.
  28. Naray-Fejes-Toth A, Fejes-Toth G. 1994 11ß-Hydroxysteroid dehydrogenase in renal collecting duct cells. Steroids. 59:105–110.[CrossRef][Medline]
  29. Albiston AL, Obeyesekere VR, Smith RE, Krozowski ZS. 1994 Cloning and tissue distribution of the human 11 beta-hydroxysteroid dehydrogenase type 2 enzyme. Mol Cell Endocrinol 105:R11–R17.
  30. Krozowski Z, Ma Guire JA, Stein-Oakley AN, Dowling J, Smith RE, Andrews RK. 1995 Immunohistochemical localization of the 11ß-hydroxysteroid dehydrogenase type II enzyme in human kidney and placenta. J Clin Endocrinol Metab. 80:2203–2209.[Abstract]
  31. Krozowski Z, Albiston AL, Obeyesekere VR, Andrews RK, Smith RE. 1995 The human 11 beta-hydroxysteroid dehydrogenase type II enzyme: comparisons with other species and localization to the distal nephron. J Steroid Biochem Mol Biol. 55:457–464.[CrossRef][Medline]
  32. Zhetcho K, Walker PD, Reeves WB. 1996 Immunolocalization of NAD-dependent 11 beta-hydroxysteroid dehydrogenase in human kidney and colon. Kidney Int. 49:271–281.[Medline]
  33. Obeyesekere VR, Ferrari P, Andrews RK, et al. 1995 The R337C mutation generates a high Km 11ß-hydroxysteroid dehydrogenase type II enzyme in a family with apparent mineralocorticoid excess. J Clin Endocrinol Metab. 80:3381–3383.[Abstract]
  34. Ferrari P, Obeyesekere VR, Li K, et al. 1996 Point mutations abolish 11ß-hydroxysteroid dehydrogenase type II activity in three families with the congenital syndrome of apparent mineralocorticoid excess. Mol Cell Endocrinol. 119:21–24.[CrossRef][Medline]
  35. DiMartino-Nardi J, Stoner E, Martin K, Balfe JW, Jose PA, New MI. 1987 New findings in apparent mineralocorticoid excess. Clin Endocrinol (Oxf). 27:49–62.[Medline]
  36. Abraham GE, Corrales PC, Teller RC. 1972 Radioimmunoassay of plasma 17-hydroxyprogesterone. Anal Lett. 5:915.
  37. Abraham GE, Manlimos FS, Solis M, Wickman AC. 1975 Combined radioimmunoassay of four steroids in one ml of plasma. II. Androgens. Clin Biochem. 8:374–378.[CrossRef][Medline]
  38. Korth-Schutz S, Levine LS, New MI. 1976 Serum androgens in normal prepubertal and pubertal children and in children with precocious adrenarche. J Clin Endocrinol Metab. 42:117–124.[Abstract]
  39. Pang S, Hotchkiss J, Drash AL, Levine LS, New MI. 1977 Microfilter paper method for 17-hydroxyprogesterone radioimmunassay. J Clin Endocrinol Metab. 45:1003–1008.[Medline]
  40. Rauh W, Levine LS, Gottesdiener K, et al. 1979 Adrenocortical function, electrolyte metabolism, and blood pressure during prolonged adrenocorticotropin infusion in juvenile hypertension. J Clin Endocrinol Metab. 49:52–57.[Abstract]
  41. Sonino N, Chow D, Levine LS, New MI. 1981 Clinical response to metyrapone as indicated by measurement of mineralocorticoids and glucocorticoids in normal children. Clin Endocrinol (Oxf). 14:31–39.[Medline]
  42. Sealey JE, Campbell G, Preibisz JJ. 1990 Renin, aldosterone, peripheral vein, renal vein, and urinary assays. In: Laragh JH, Brenner BM, eds. Hypertension pathophysiology: diagnosis and managment. New York: Raven Press; 1443–1459.
  43. Shackleton CHL. 1993 Mass spectrometry in the diagnosis of steroid-related disorders and in hypertension research. J Steroid Biochem Mol Biol. 45:127–140.[CrossRef][Medline]
  44. Hellman L, Nakada F, Zumoff B, Fukushima D, Bradlow HL, Gallagher TF. 1971 Renal capture and oxidation of cortisol in man. J Clin Endocrinol Metab. 33:52–62.[Medline]
  45. Wilson RC, Wei JQ, Cheng KC, Mercado AB, New MI. 1995 Rapid DNA analysis by allele-specific PCR for detection of mutations in the steroid 21-hydroxylase gene. J Clin Endocrinol Metab. 80:1635–1640.[Abstract/Free Full Text]
  46. Coleman JP, White WB, Lijewski M, Hylemon PB. 1988 Nucleotide sequence and regulation of a gene involved in bile acid 7-dehydroxylation by Eubacterium sp. strain VPI 12708. J Bacteriol. 170:2070–2077.[Abstract/Free Full Text]
  47. Ghosh D, Weeks CM, Grochulski P, et al. 1991 Three-dimensional structure of holo 3 alpha,20 beta-hydroxysteroid dehydrogenase: a member of a short-chain dehydrogenase family. Proc Natl Acad Sci USA. 88:10064–10068.[Abstract/Free Full Text]
  48. Krozowski Z. 1992 11ß-Hydroxysteroid dehydrogenase and the short-chain alcohol dehydrogenase (SCAD) superfamily. Mol Cell Endocrinol. 84:C25–C31.
  49. Chou PY, Fasman GD. 1974 Prediction of protein conformation. Biochemistry. 13:222–245.[CrossRef][Medline]
  50. Chou PY, Fasman GD. 1974 Conformational parameters for amino acids in helical, beta-sheet, and random coil regions calculated from proteins. Biochemistry. 13:211–222.[CrossRef][Medline]
  51. Chou PY, Fasman GD. 1978 Prediction of the secondary structure of proteins from their amino acid sequence. Adv Enzymol Relat Areas Mol Biol. 47:45–148.[Medline]
  52. Chou PY, Fasman GD. 1978 Empirical predictions of protein conformation. Annu Rev Biochem. 47:251–276.[CrossRef][Medline]
  53. Brown RW, Chapman KE, Edwards CR, Seckl JR. 1993 Human placental 11 beta-hydroxysteroid dehydrogenase: evidence for and partial purification of a distinct NAD-dependent isoform. Endocrinology. 132:2614–2621.[Abstract]
  54. Brown RW, Chapman KE, Kotelevtsev Y, et al. 1996 Cloning and production of antisera to human placental 11ß-hydroxysteroid dehydrogenase type 2. Biochem J. 313:1007–1017.
  55. Benediktsson R, Calder AA, Edwards CRW, Seckl JR. 1997 Placental 11 beta-hydroxysteroid dehydrogenase: a key regulator of fetal glucocorticoid exposure. Clin Endocrinol (Oxf). 46:161–166.[CrossRef][Medline]
  56. Stewart PM, Rogerson FM, Mason JI. 1995 Type 2 11ß-hydroxysteroid dehydrogenase messenger ribonucleic acid and activity in human placenta and fetal membranes: its relationship to birth weight and putative role in fetal adrenal steroidogenesis. J Clin Endocrinol Metab. 80:885–890.[Abstract]
  57. Edwards CR, Benediktsson R, Lindsay RS, Seckl JR. 1996 11 beta-hydroxysteroid dehydrogenases: key enzymes in determining tissue-specific glucocorticoid effects. Steroids. 61:263–269.[CrossRef][Medline]
  58. Benediktsson R, Noble J, Calder AA, Edwards CRW, Seckl JR. 1995 11ß-Hydroxysteroid dehydrogenase activity in intact dually-perfused fresh human placenta predicts birth weight. J Endocrinol. 144(Suppl):166.
  59. Gomez-Sanchez EP, et al. 1995 The modulation of central control of blood pressure. Steroids. 60:69–72.[CrossRef][Medline]
  60. Roberts AJ, Keith LD. 1995 Corticosteroids enhance convulsion susceptibility via central mineralocorticoid receptors. Psychoneuroendocrinology. 20:891–902.[CrossRef][Medline]
  61. Gomez-Sanchez EP, Zhou M, Gomez-Sanchez CE. 1996 Mineralocorticoids, salt and high blood pressure. Steroids. 61:184–188.[CrossRef][Medline]



This article has been cited by other articles:


Home page
ReproductionHome page
C. J McNeil, M. O Nwagwu, A. M Finch, K. R Page, A. Thain, H. J McArdle, and C. J Ashworth
Glucocorticoid exposure and tissue gene expression of 11{beta} HSD-1, 11{beta} HSD-2, and glucocorticoid receptor in a porcine model of differential fetal growth
Reproduction, March 1, 2007; 133(3): 653 - 661.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
G. Morineau, V. Sulmont, R. Salomon, B. Fiquet-Kempf, X. Jeunemaitre, J. Nicod, and P. Ferrari
Apparent Mineralocorticoid Excess: Report of Six New Cases and Extensive Personal Experience
J. Am. Soc. Nephrol., November 1, 2006; 17(11): 3176 - 3184.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Zandi-Nejad, V. A. Luyckx, and B. M. Brenner
Adult Hypertension and Kidney Disease: The Role of Fetal Programming
Hypertension, March 1, 2006; 47(3): 502 - 508.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. W. Kim, U. K. Schou, C. D. Peters, S. de Seigneux, T.-H. Kwon, M. A. Knepper, T. E.N. Jonassen, J. Froki, and S. Nielsen
Increased Apical Targeting of Renal Epithelial Sodium Channel Subunits and Decreased Expression of Type 2 11{beta}-Hydroxysteroid Dehydrogenase in Rats with CCl4-Induced Decompensated Liver Cirrhosis
J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3196 - 3210.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. M. Paterson, J. R. Seckl, and J. J. Mullins
Genetic manipulation of 11{beta}-hydroxysteroid dehydrogenases in mice
Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2005; 289(3): R642 - R652.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
N. Draper and P. M Stewart
11{beta}-Hydroxysteroid dehydrogenase and the pre-receptor regulation of corticosteroid hormone action
J. En