| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Special Articles |
Department of Pediatrics, Division of Pediatric Endocrinology, New York Hospital-Cornell Medical Center, New York, New York 10021
Address all correspondence and requests for reprints to: Maria I. New, M.D., Department of Pediatrics, Division of Pediatric Endocrinology, New York Hospital-Cornell Medical Center, 525 East 68th Street, Room M-420, New York, New York 10021. E-mail: lavander{at}mail.med.cornell.edu
| Abstract |
|---|
|
|
|---|
All of the patients had characteristic signs of a severe 11ßHSD2 defect. Birth weights were significantly lower than those of their unaffected sibs. The patients were short, underweight, and hypertensive for age. Variable damage of one or more organs (kidneys, retina, heart, and central nervous system) was found in all of the patients except one. The follow-up studies of end-organ damage after 213 yr of treatment in six patients demonstrated significant improvement in all patients.
The urinary metabolites of cortisol demonstrated an abnormal ratio with
predominance of cortisol metabolites, i.e.
tetrahydrocortisol plus 5
-tetrahydrocortisol/tetrahydrocortisone was
6.733, whereas the normal ratio is 1.0. Infusion of
[11-3H]cortisol resulted in little release of tritiated
water, indicating the failure of the conversion of cortisol to
cortisone.
Thirteen mutations in the HSD11B2 gene have been previously published, and we report three new genetic mutations in two patients, one of whom was previously unreported. All of the patients had homozygous defects except one, who was a compound heterozygote. Our first case had one of the most severe mutations, resulting in the truncation of the enzyme 11ßHSD2, and died at the age of 16 yr while receiving treatment. Three patients with identical homozygous mutations from different families had varying degrees of severity of clinical and biochemical features. Due to the small number of patients with identical mutations, it is difficult to correlate genotype with phenotype.
In some cases, early and vigilant treatment of AME patients may prevent or improve the morbidity and mortality of end-organ damage such as renal or cardiovascular damage and retinopathy. The outcome of treatment in more patients may establish the efficacy of treatment.
| Introduction |
|---|
|
|
|---|
| Background |
|---|
|
|
|---|
The clinical features of AME were first reported by Werder et al. in 1974 (2); in 1977, New et al. described the biochemical features (1, 25) in a 3-yr-old Native American girl from the Zuni tribe. Although this patient had clinical manifestations of hyperaldosteronism, she had very low levels of aldosterone and very low secretion rates of corticosteroids. Several attempts were made to identify an unknown steroid that could act as a mineralocorticoid, but none was found. Later it was shown that there was a deficiency in 11ß-hydroxy-steroid dehydrogenase (11ßHSD) activity (3, 26). It was postulated that the mineralocorticoid specificity of the mineralocorticoid receptor was lost in patients with AME due to a defect in the enzyme 11ßHSD.
Although aldosterone is a more potent mineralocorticoid than cortisol, the mineralocorticoid receptor binds these hormones with equal affinity (27). The type 2 isoform of the 11ßHSD enzyme functions unidirectionally to convert cortisol to cortisone, which does not bind to the mineralocorticoid receptor. Normal subjects are protected from cortisol intoxication by the action of 11ßHSD2. Aldosterone is not metabolized by the 11ßHSD enzyme because it is a ß-lactone, and thus it has unimpeded access to the mineralocorticoid receptor. As cortisol is secreted in milligram amounts whereas aldosterone is secreted in microgram amounts, cortisol saturates the mineralocorticoid receptor in patients with deficient 11ßHSD2 enzyme activity. The resulting inappropriate binding of cortisol to the mineralocorticoid receptor causes sodium retention and volume expansion that suppresses plasma renin and aldosterone secretion and causes potassium excretion and hypokalemia. Signs of mineralocorticoid excess due to cortisol binding to the mineralocorticoid receptor in the absence of aldosterone are the hallmark of the disease.
Although it was initially thought that a mutation in the gene for the hepatic form of the NADP-dependent enzyme 11ßHSD (HSD11B1) was responsible for the disorder, no mutations were found in affected patients (20). Subsequently, a second isoenzyme, 11ßHSD2, which is NAD-dependent, was demonstrated in the rabbit to be active in the kidney (28). The 11ßHSD2 enzyme was found in the renal collecting duct cells and was postulated to be an isoform of the hepatic enzyme that would ensure aldosterone specificity in mineralocorticoid target cells. The complementary DNA (cDNA) and gene for 11ßHSD2 (HSD11B2) were then cloned and mapped to human chromosome 16q22 (10, 29). Immunohistological studies localized the type 2 isoform to the distal nephron of the human kidney (30, 31, 32).
In 1995, the first genetic mutation (R337C) in the HSD11B2 gene was detected in a family from Iran with three AME-affected children (8). Thirteen specific mutations in the HSD11B2 gene have been reported to date (8, 9, 10, 11, 22, 23, 24). Herein we report three previously unpublished mutations in two patients with AME. In our patients, the various mutations all occur in the coding region of HSD11B2. However, Mune et al. reported one mutation in intron 3 outside the coding region (10). The mutations significantly decrease enzymatic activity, as recent in vitro expression studies have shown (10, 22, 33, 34). Mutations were introduced into HSD11B2 cDNA, subcloned, and transfected into CHOP cells, and the transfectants were then tested for their ability to convert physiological concentrations of cortisol to cortisone, or corticosterone to 11-dehydrocorticosterone. It was shown that the mutants expressed no activity or greatly reduced enzymatic activity compared to the wild types.
| Subjects and Methods |
|---|
|
|
|---|
All of the patients had characteristic signs of a severe 11ßHSD2
defect, i.e. low birth weight, failure to thrive, poor
growth, marked hypokalemia, significant low renin hypertension, low to
absent secretion of adrenal steroids, and markedly impaired capacity to
convert cortisol to cortisone. The referring physicians have provided
records of previous care, and in all cases the diagnosis was made or
confirmed at NYH-CMC at the Childrens Clinical Research Center (Table 1
).
|
Twelve of the 14 patients and their families have been
previously described (Fig. 1
) (1, 8, 9).
|
Patient I-1
Patient I-1 was briefly reported in (20) but was not hormonally
or genetically evaluated. Patient I-1 is an Italian-Moroccan male, a
product of a nonconsanguineous marriage (Fig. 1
). His birth weight was
2.25 kg at 40 weeks gestation. Birth was by spontaneous vaginal
delivery. At 1 month of age he was noted to have polyuria and
polydipsia. Hypertension (blood pressure, 160/110 mm Hg) was first
noticed at the age of 4 yr. He underwent an endocrinological
evaluation, which revealed low renin hypertension. At age 10 yr, AME
was diagnosed, which was confirmed at NYH-CMC at the age of 10.5 yr. On
examination at NYH-CMC, he was a prepubertal male with a height of
132.7 cm (height z-score, -1.26 SD) and a weight of 29.2
kg (weight, z-score, -0.58 SD). His baseline blood
pressure was 140180/90100 mm Hg (90th percentile for age is
115/73). Fundoscopic examination revealed grade I hypertensive
retinopathy. The initial laboratory serum values were as follows:
potassium, 2.6 mmol/L; sodium, 139 mmol/L; CO2, 31 mmol/L;
blood urea nitrogen, 8 mmol/L; and creatinine, 0.5 mg/dL. PRA was
markedly suppressed (0.08 ng/mL·h). Serum and urinary aldosterone and
serum deoxycorticosterone were undetectable by RIA. The chest x-ray
revealed mild cardiomegaly and fullness in the ascending aorta, and an
electrocardiogram demonstrated left ventricular hypertrophy. Urine
analysis was significant for alkaline pH (7.58) and for
hypercalciuria and triple phosphate crystals. Creatinine clearance
ranged from 78180 mL/min·1.73 m2. Nephrocalcinosis in
the renal pyramids was observed on renal sonography. Bone age was
appropriate for chronological age. The results of his endocrine
evaluation at NYH-CMC are shown in Tables 24![]()
![]()
.
He was treated with spironolactone (100 mg, twice daily), which was
raised to 150 mg, twice daily. Thiazide diuretic and potassium
supplementation were added for better control of serum electrolytes and
blood pressure. The results of follow-up studies are shown in Table 5
.
|
|
|
|
Laboratory methods and procedures
The patients were studied under an institutionally approved protocol at the Childrens Clinical Research Center of NYH-CMC. Blood pressures were measured every 2 h with a mercury sphygmomanometer after the patient had been supine for at least 10 min throughout their hospitalization. Patients were given diets calculated for calories, sodium, and potassium by the Childrens Clinical Research Center kitchen. Their 24-h urine samples were collected and checked for urinary steroids, sodium, potassium, calcium, and creatinine. Blood samples for adrenal steroid, PRA, and electrolyte determinations were collected daily at 0800 h. The results for blood pressure, electrolytes, and steroids were reported at baseline phase while patients were receiving a normal sodium diet and without medication.
Hormone analysis
Serum cortisol, aldosterone, deoxycorticosterone, and corticosterone were measured according to previously reported methods (36, 37, 38, 39, 40, 41). PRA was measured by the method of Sealey et al. (42). Urinary steroid metabolites were measured by assays described by Shackleton et al. (43).
Cortisol studies
To determine cortisol secretion rates and cortisol half-life, we followed the previously described protocols (1, 3, 35).
To establish the dysfunction of the 11ßHSD2 enzyme, the metabolism of cortisol to cortisone was determined by measuring the release of tritiated water after [11-3H]cortisol infusion. [3H]Cortisol infusion was performed according to the method reported by Hellman et al. (44). Tritiated water was recovered from the plasma by lyophilization.
DNA analysis
DNA sequencing was carried out after two rounds of PCR. In the first PCR, 100500 ng genomic DNA (obtained from peripheral blood leukocytes) as previously described (45) were denatured for 10 min at 98 C and amplified using primers 54 GTGACTCTGGTTTTGGCAAGGA and 58 AAGTACAGTACATGCTTCCCTGTGG. The following reagents were added to the denatured DNA: 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 1.5 mmol/L MgCl2, 0.01% gelatin, 0.75 U Taq (Life Technologies, Grand Island, NY) polymerase, 200 µmol/L deoxy-NTP, and 0.3 µmol/L of each primer. The samples were subjected to denaturation at 94 C for 2 min. Five cycles, consisting of 94 C for 1 min, 60 C for 1.5 min, and 72 C for 10 min, were performed, followed by 30 cycles, consisting of 94 C for 1 min, 60 C for 1.5 min, and 72 C for 4 min. A final cycle consisted of 94 C for 1 min, 60 C for 1.5 min, and 72 C for 10 min.
The second PCR was performed in a 50-µL reaction containing 2 µL
from the first PCR, with 15 pmol forward primer and 5 pmol reverse
biotin primer (see Table 6
). The
remaining reagents were identical to those of the first PCR. The
samples were denatured for 1 min at 95 C, followed by 4 cycles of 1 min
at 95 C, 30 s at 58 C, and 10 min at 72 C; followed by 30 cycles
of 30 s at 95 C, 30 s at 58 C, and 1 min at 72 C; followed by
1 cycle of 1 min at 95 C, 1.5 min at 58 C, and 10 min at 72 C.
|
DNA sequencing
Sequencing of the HSD11B2 gene was performed using solid phase single strand sequencing with the Sequenase Dye Primer Kit (Applied Biosystems, Foster City, CA) containing M13 primers. Single stranded DNA from the PCR fragments were purified with streptavidin-bound magnetic beads (Dynal, Oslo, Norway), following the procedure in Bulletin 21 from Applied Biosystems. After denaturation to remove the nonbiotinylated DNA strand, the bound DNA strand was sequenced. Sequencing was performed according to the procedure described in the sequencing manual supplied with the sequencing kit. The sequencing products were electrophoresed and analyzed with an Applied Biosystems model 373A sequencer.
Expression studies
In vitro expression studies using cDNAs with the mutations found in the HSD11B2 gene of patients A-1, D-1, D-2, and F-2 were performed as described previously (34) and with the mutations found in patients H-1, H-2 and H-5 as described previously (33). In vitro expression studies, using a different expression system in patients B-1, C-1, E-1, G-5, and G-6, were reported by Mune et al. (10).
| Results |
|---|
|
|
|---|
The features of our AME patients at first presentation to
their primary or referring physicians are presented in Table 1
. The
patients were of varied ethnic ancestry. Ages ranged from 114 yr, and
the male to female ratio was 9:5. All of the patients were born with
low birth weight compared to unaffected sibs (Table 7
). The gestational age for patients A-1,
C-1, and F-2 was 36 weeks; the gestational age of the rest of the
patients was 3940 weeks (Table 7
). All of the patients demonstrated
failure to thrive in their early childhood. The majority of our
patients had polyuria and polydipsia as a consistent presenting feature
in early childhood due to nephrogenic diabetes insipidus secondary to
hypokalemic nephropathy. The height z-score for our patients ranged
from -4.2 to -0.6 (with the one exception of patient D-2, whose
height z-score was 0.33), and the weight z-score ranged from -3.9 to
-0.6. All of the patients had significant hypertension compared to the
90th percentile for normal age- and sex-matched children. Hypokalemic
alkalosis was observed in all of the patients.
|
Before the arrival and evaluation of our AME patients at NYH-CMC,
either patients had never been treated with spironolactone (patients
A-1, D-1, D-2, G-5, G-6, and J-3), or spironolactone was discontinued
for variable periods of time (10 days to 3 months). The clinical signs
and biochemical features on their admission to NYH-CMC are presented in
Table 2
. All patients had severe hypertension and hypokalemic
alkalosis. Cortisol secretion rates were measured in 10 patients. All
of the patients tested had very low rates, ranging from 0.050.83
mg/day, compared to the normal secretion rate of 525 mg/day. We
studied the cortisol half-life in 5 patients, all of whom had a longer
than normal result (ranging from 113187 min, compared to the normal
value of 80 min). Eight patients were tested for the conversion of
cortisol to cortisone. Of those, none could convert more than 6% of
cortisol to cortisone, compared to 9095% conversion in the normal
population. The tetrahydrocortisol (THF) plus
5
THF/tetrahydrocortisone (THE) ratio, representing the major urinary
metabolites of cortisol (THF) and cortisone (THE), was significantly
elevated in all of the patients. In patient B-1, the THF/THE ratio was
tested instead, which was 9 (normal,
1). Thirteen patients were found
to have a homozygous mutation for the HSD11B2 gene. One patient (I-1)
was a compound heterozygote (Fig. 1
).
Molecular analysis
Nine specific mutations in the HSD11B2 gene have been
identified in our patients (Fig. 2
, Table 2
). Mutations in patients AH were
previously described (8, 9). Sequence analysis of the HSD11B2 gene in
patients I and J are reported for the first time. Patient I-1 carries a
novel heterozygous T to G transversion in the second nucleotide of
codon 250, resulting in a substitution of the leucine with an arginine
(L250R) inherited from his father, and he carries a novel
heterozygous G to A transition in the first nucleotide of codon 244,
resulting in a substitution of an aspartic acid with an asparagine
(D244N) inherited from his mother (Fig. 1
). Patient J-3 carries a novel
homozygous 1-base deletion (N286 -1 frame shift) of a C nucleotide,
either in the third nucleotide of codon 286 (AAC) or in the first
nucleotide of codon 287 (CTG), resulting in a truncated and missense
N-terminus of 11ßHSD2. Both the mother and the father were
heterozygous for this deletion, and the unaffected sib was homozygous
normal (Fig. 1
).
|
In vitro expression studies using mutations found in
patients AH revealed no conversion of cortisol to cortisone, with the
exception of the mutation found in patients G-5 and G-6, which showed
7% conversion (Table 2
) (10, 33, 34). As these patients were
clinically symptomatic, 7% activity may not be enough for normal
cortisol metabolism.
In vitro expression studies were not performed for patients I-1 and J-3. Krozowski and colleagues were able to assign functional domains to 11ßHSD2 by comparing its amino acid sequence to other short chain alcohol dehydrogenases (46, 47, 48). The D244N mutation found in patient I-1 falls within the D domain, which is presumed to be the active site. Using the algorithm developed by Chou and Fasman (49, 50, 51, 52), the predicted secondary structure from the D244N mutation compared to the normal 11ßHSD2 enzyme would result in truncation of the helix structure that is formed in the D domain. The analysis by Chou and Fasman of the L250R mutation found on patient I-1s other HSD11B2 allele suggests that this results in an introduction of turns between the D and E domains. The analysis by Chou and Fasman of the L250P, L251S mutation, which is known to be responsible for absent in vitro 11ßHSD2 activity and when homozygous results in AME (9, 10, 34), suggests the same introduction of turn structures between the D and E domains. Thus, the compound heterozygous D244N and L250R mutations found in patient I-1 most likely result in diminution of enzymatic activity. The homozygous deletion of the C nucleotide in patient J-3 results in termination at codon 322 instead of 405, with missense amino acids from codon 287 to codon 322. The N286 -1 frame shift found in patient J-3 should be equal to or more deleterious than the mutation in patient A-1 (E356 -1 frame shift), which results in termination at codon 395 and showed no conversion of cortisol to cortisone in expression studies (34).
Steroid levels and PRA evaluated at NYH-CMC
The hormone levels in the patients newly described herein conform
to those found in the patients previously reported (Table 3
). All serum
steroid levels were low, except for deoxycorticosterone and cortisol,
which ranged from undetectable to normal levels. The normal serum
concentration of cortisol despite a low secretion rate is probably owed
to its long half-life (Table 2
).
Complications (end-organ damage)
End-organ damage was observed frequently in our AME patients
(Table 4
). The urinary calcium/creatinine ratio was established for the
patients after treatment was discontinued, with the exception of
patients H-1, H-2, and H-5, who remained on spironolactone. Seven of 12
(58.3%) patients had hypercalciuria, with a ratio ranging from
0.230.73 (normal calcium to creatinine ratio, <0.2).
Nephrocalcinosis was found in 8 of 14 (57.1%) patients, including
patient B-1, whose urinary calcium to creatinine ratio was normal.
Patient H-1 did not have nephrocalcinosis, although her kidneys had
decreased in size, and her serum creatinine concentration was high.
Hypertensive retinopathy was reported by ophthalmologists in 10 of 14
(71.4%) patients. A cardiac evaluation gave evidence of left
ventricular hypertrophy by electrocardiogram and/or echocardiogram in
11 of the 14 (78.6%) patients. A history of developmental delay was
reported by a primary care physician in 4 patients. A history of
transient or permanent neurological defects was found in 8 of 14
(57.1%) of the patients. Electroencephalographic examination revealed
5 of 10 (50%) patients to have a pattern consistent with generalized
seizure disorder or generalized cerebral dysfunction, although none had
confirmed clinical seizures. The parents of patient F-2 reported that
he had momentary blank stares and lapses of awareness from seconds to
minutes at a time (with no history of clonic jerks), suggestive of
absence seizures. Three of 9 (33.3%) patients who had magnetic
resonance imaging of the brain had a morphological abnormality. Patient
B-1 had infarct in the internal capsule of the brain, patient E-1 had
left cerebellar infarct, and patient G-5 had a nonspecific finding of a
small arachnoid cyst in the brain.
Response to administration of hydrocortisone and spironolactone
We studied the effects of hydrocortisone and spironolactone
administration in AME patients previously (26). Herein we report the
results of two additional patients studied. After stabilizing the
patients with the optimum dose of spironolactone (300 mg/day) that
controlled their blood pressure and serum electrolytes, hydrocortisone
(2 mg/day, 4 times their endogenous secretion rate) was administered
for 3 days, followed by 10 mg/day for 3 days. In both patients,
mineralocorticoid blockade was overcome (Table 8
) with doses of hydrocortisone
simulating stress, as shown by the decrease in serum K+,
suppression of PRA, and gradual and significant rise in mean 24-h blood
pressure.
|
Sodium balance in five patients have been previously reported (1, 3, 35). Six additional patients were studied in a protocol in which a low salt diet containing 10 mEq sodium was administered. All six patients (E-1, F-2, G-5, G-6, I-1, and J-3) retained sodium and lowered the urinary excretion of sodium to less than 10 mEq/day. Serum potassium rose, and the blood pressure fell. Further, all five patients responded to spironolactone administration by lowering their blood pressure, raising serum potassium, and slowly increasing PRA and serum aldosterone levels. When hydrochlorothiazide was added to the spironolactone administration, the blood pressure fell to normal. In four of the five patients, ACTH was administered and caused a rise in blood pressure and a fall in serum potassium. These studies were similar to those performed on the previously reported patients.
Follow-up of end-organ damage after treatment
Six patients were reevaluated 210 yr after their initial
diagnosis at NYH-CMC. The change in end-organ damage is reported in
Table 5
. The treatment of all of those patients consisted of
spironolactone (dose range, 212.5 mg/kg·day), hydrochlorothiazide
(dose range, 0.23 mg/kg·day), and potassium supplement in some, as
required. The heights of four of six patients showed variable
improvement with treatment. Although the height z-score of patient I-1
did not improve, it is still consistent with his target height
z-score.
Body mass index improved compared to the pretreatment value. Hypercalciuria improved in all of the patients. Sonographic evidence of nephrocalcinosis resolved in three of four patients. Pretreatment cardiac damage in the form of left ventricular hypertrophy was present in all six patients. The follow-up echocardiographic studies showed the absence of left ventricular hypertrophy in four patients and improvement in the other two patients. Hypertensive retinopathy was reversed after treatment in five patients and improved in one.
The follow-up of the clinical status of the majority of our other patients was reported by personal communication with local physicians. As we have previously mentioned, patient A-1 died suddenly at the age of 16 yr while being treated with spironolactone and thiazide diuretic. Patient B-1 may be the oldest survivor with this disease. He is 35 yr old, married, and working in Australia. His blood pressure is intermittently elevated, for which he is receiving spironolactone therapy along with other antihypertensive drugs (Enalapril, Amiloride, and Persantin). Bilateral nephrocalcinosis persists with normal serum creatinine and mild hypertensive retinopathy. At 30 yr of age he was diagnosed with an aortic aneurysm that involved the aortic root and aortic valve, which was treated with valve replacement surgery. A current electrocardiogram showed high QRS voltages and T-wave changes, with multiple ventricular extrasystoles. Patients D-1 and D-2 were lost for follow-up; according to their mother, they continue to be hypertensive. Their final height is 60 in. (target height is 66 in.). Patient H-1 had delayed puberty, as menarche occurred at 16 yr of age. She has severe hypertensive retinopathy, evident by the presence of hemorrhages and exudates in the retina. She has genu valgum associated with low serum calcium concentration, and high alkaline phosphatase and PTH levels. Her kidneys are severely damaged, with renal insufficiency evident from high serum creatinine levels. Patient H-2s hypertensive retinopathy is improved, and he is in good health. Patient H-5 is in good health without any signs of end-organ damage.
| Discussion |
|---|
|
|
|---|
A deficiency of 11ßHSD2 in the fetus may lead to intrauterine growth retardation and low birth weight, as evidenced by the low birth weight of AME patients compared to the normal birth weights of unaffected sibs. These data do not suggest a maternal or environmental cause of low birth weights in our patients, because if this was the cause, the birth weights of the sibs would be similarly affected.
The human placenta is reported to have abundant type 2 isoform (NAD-dependent) of 11ßHSD (53, 54). Benediktsson et al. reported that placental 11ßHSD2 actively converts cortisol to cortisone (55). It has been reported that there is a positive correlation between normal placental 11ßHSD type 2 activity and birth weight (56). We have shown that in patients affected with 11ßHSD2 deficiency, birth weight is low. This has been attributed to a deficiency of placental 11ßHSD2 (57, 58). However, this hypothesis requires further investigation.
As has been described, families with AME demonstrate consanguinity or endogamy (8, 9). For example, patient A-1 belongs to the Parrot Clan of the Zuni tribe, which resides on a restricted reservation in New Mexico. Both parents are members of the Parrot Clan. The parents in family G are from a tribe of about 10,000 people called the Mozaini Tribe in which consanguinity and tribal inbreeding are the custom. Both of the closed societies in families A and G appear to have knowledge of the effects of endogamy and have tried to develop methods to avoid its negative genetic consequences. Consanguinity is also present in families F and H. Family F is Native American of the Chippewa Tribe; as evidenced in the pedigree, the mothers grandparents are the fathers maternal grandparents. Family H comes from rural Iran near Hamedan; the parents are first cousins. Family B is Zoroastrian from Iran, and families C and E come from the area of India to which Zoroastrians emigrated. Although families C and E claim to be Hindu, it is possible that they have a common Zoroastrian ancestor and have identity by descent. Family D is African-American, and although consanguinity is denied, it should be noted that the African-American population was restricted in its marital practices when it first arrived in the United States.
In families J and I, we have no verification of consanguinity. Family J is a religious Muslim family, all of whom originated from the same village in Turkey. Although there is no confirmed history of consanguinity in patient J-3s parents, relatives of family J report that there was consanguinity two or more generations previously. As both parents are heterozygous for the same mutation, consanguinity is possible. As family I is clearly nonconsanguineous, it is not surprising that the patient is a compound heterozygote. However, the compound heterozygosity did not result in a mild form of the disease, suggesting the absence of genetic complementarity.
It is difficult to make phenotypic correlations with the genotypes we
have identified among our patients due to the small number of patients
with identical mutations. In an attempt to examine two patients with
highly similar mutations, we have compared patients A-1 and J-3 to each
other, as their mutations both result in truncations of 11ßHSD2.
Patient J-3s mutation would be expected to be at least equal to or
more severe than that of patient A-1 because the truncation is more
premature. Yet, patient A-1 had more severe complications in the form
of her clinical presentation, such as lower birth weight, greater
failure to thrive, more severe hypertension, and presence of left
ventricular hypertrophy, and in her biochemical presentation, such as a
higher THF plus 5
THF/THE ratio and absent cortisol to cortisone
conversion compared to those of patient J-3. Patient A-1 died suddenly
at age 16 yr of unclear cause despite being treated for her disease.
The fact that this patient died and also has one of the most severe
mutations molecularly suggests a relationship of genotype to phenotype.
For this reason, patient J-3 must be monitored carefully to ensure that
his disease is controlled, as he is much younger than when A-1 died,
and his genotypic similarity may put him at risk for severe
complications.
Patients B-1, C-1, and E-1 carry the same homozygous mutation. However,
these patients have varying degrees of severity in clinical and
biochemical features. An examination of many parameters reveals little
consistency; birth weight, failure to thrive, hypertension,
nephrocalcinosis, left ventricular hypertrophy, neurological damage,
THF plus 5
THF/THE ratio, and defects in cortisol to cortisone
conversion ranged from mild to severe in all three patients.
Patients D-1 and D-2 have the same mutation, and clinical and biochemical aspects were similar. Genotype also correlates with phenotype in patients G-5 and G-6, and among sibs H-1, H-2, and H-5. However, patients D-1 and H-1 showed greater severity of their disease than their sibs, although this could be attributed to their later diagnosis and later treatment initiation than their younger sibs.
Severe hypertension and hypokalemic alkalosis are associated with end-organ damage in AME patients, particularly of the retina, kidney, and cardiovascular and central nervous systems. Cardiac damage is manifested mainly in the form of concentric left ventricular hypertrophy with increased left ventricular mass. Kidney manifestations are seen in the form of hypercalciuria, nephrocalcinosis, and in some cases renal insufficiency. Hypertensive retinopathy is consistently found in all patients, ranging from mild to moderate grades. The presence of abnormal findings in electroencephalogram studies, performed after normalizing serum electrolytes, is suggestive of central nervous system dysfunction and seizure disorder; the absence of seizures requires further explanation. This is a particularly important observation in light of the emerging central nervous system roles for mineralocorticoids (59, 60, 61).
The follow-up studies of complications in AME patients are
reported in Table 5
. We treated our AME patients with spironolactone, a
mineralocorticoid receptor blocker, and demonstrated improvements in
their clinical symptoms. The dose range of spironolactone was wide
(210 mg/kg·day). The spironolactone was started at a very low dose
and was gradually increased until the desired blood pressure response
and serum potassium concentration were achieved. As hypercalciuria and
nephrocalcinosis are consistent features of this disease, thiazide
diuretic was added in most of our patients treatment regimens. The
reversal of bilateral nephrocalcinosis of the kidneys in our patients
is evidence of the success of treatment. Thiazide diuretics also aid in
lowering blood pressure and in some patients may allow for the dose of
spironolactone to be reduced. This is particularly important in
patients manifesting antiandrogenic side-effects (e.g.
gynecomastia) of spironolactone. The improved growth and the reversal
of hypertensive retinopathy and left ventricular hypertrophy further
demonstrate that proper treatment and meticulous compliance are able to
control this severe and sometimes fatal disease.
We have reported that hydrocortisone administration raised the blood pressure and lowered the serum potassium concentration in all patients with AME (1, 26, 35). In two additional patients we studied, patients G-5 and G-6, hydrocortisone administration increased the mean 24-h blood pressure and lowered the serum potassium level significantly despite the administration of spironolactone treatment. This suggests the possibility that routine doses of spironolactone, although high, may be inadequate to accommodate high endogenous cortisol secreted during stressful periods of life.
The diagnosis of AME should be suspected in patients with the features
of low birth weight, failure to thrive, polyuria/polydipsia, and
hypertension. The baseline evaluation should include biochemical
evidence of hypokalemic alkalosis, hyporeninemia, and
hypoaldosteronemia, which are typical biochemical features of AME. If
PRA and aldosterone are suppressed; the diagnosis of 11ß-hydroxylase
deficiency, 17
-hydroxylase deficiency, or a
deoxycorticosterone-producing tumor has been excluded; and excess
licorice ingestion is denied, a 24-h urine test for cortisol
metabolites should be performed and analyzed for the ratio of THF plus
5
THF/THE. The ideal biochemical diagnostic procedure involves
testing for the conversion of [3H]cortisol to
[3H]cortisone by measuring 3H2O
release after injecting [11-3H]cortisol; however, this
test is technically difficult and not widely available. DNA analysis
will confirm the diagnosis upon identification of a homozygous or
compound heterozygous mutation in the HSD11B2 gene and should be used
as a tool in genetic counseling for the affected families.
In some cases, early and vigilant treatment of AME patients may prevent or improve the morbidity and mortality of end-organ damage, such as renal or cardiovascular damage and retinopathy. The outcome of treatment studied in more patients may establish efficacy of treatment.
In the past, it was believed that receptors determined the specificity of hormone action. In this respect, AME has opened up a new field of receptor biology by demonstrating that receptors can be promiscuous with respect to ligands. The specificity of the mineralocorticoid receptor depends on the 11ßHSD enzyme.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received February 9, 1998.
Accepted April 14, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. J McNeil, M. O Nwagwu, A. M Finch, K. R Page, A. Thain, H. J McArdle, and C. J Ashworth Glucocorticoid exposure and tissue gene expression of 11{beta} HSD-1, 11{beta} HSD-2, and glucocorticoid receptor in a porcine model of differential fetal growth Reproduction, March 1, 2007; 133(3): 653 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Morineau, V. Sulmont, R. Salomon, B. Fiquet-Kempf, X. Jeunemaitre, J. Nicod, and P. Ferrari Apparent Mineralocorticoid Excess: Report of Six New Cases and Extensive Personal Experience J. Am. Soc. Nephrol., November 1, 2006; 17(11): 3176 - 3184. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zandi-Nejad, V. A. Luyckx, and B. M. Brenner Adult Hypertension and Kidney Disease: The Role of Fetal Programming Hypertension, March 1, 2006; 47(3): 502 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Kim, U. K. Schou, C. D. Peters, S. de Seigneux, T.-H. Kwon, M. A. Knepper, T. E.N. Jonassen, J. Froki, and S. Nielsen Increased Apical Targeting of Renal Epithelial Sodium Channel Subunits and Decreased Expression of Type 2 11{beta}-Hydroxysteroid Dehydrogenase in Rats with CCl4-Induced Decompensated Liver Cirrhosis J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3196 - 3210. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Paterson, J. R. Seckl, and J. J. Mullins Genetic manipulation of 11{beta}-hydroxysteroid dehydrogenases in mice Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2005; 289(3): R642 - R652. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Draper and P. M Stewart 11{beta}-Hydroxysteroid dehydrogenase and the pre-receptor regulation of corticosteroid hormone action J. En |