| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
The Jackson Laboratory (C.J.R., D.V.), Bar Harbor, Maine 04605; Department of Medicine (E.S.K., J.P.B.) and Department of Pharmacology (J.P.B.), College of Physicians and Surgeons, Columbia University, New York, New York 10032; Medical College of Virginia and McGuire Veterans Administration Hospital (R.A.A.), Richmond, Virginia 23249; Beth Israel Medical Center (P.J.R.), New York, New York 10003; Foundation for Blood Research (W.Y.C.), Scarborough, Maine 04070; and Southwest Foundation for Biomedical Research (S.W., J.R.), San Antonio, Texas 78228
Address all correspondence and requests for reprints to: Clifford J. Rosen, Maine Center for Osteoporosis Research and Education, St. Joseph Hospital, 360 Broadway, Bangor, Maine 04401. E-mail: crosen{at}maine.maine.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
IGF-I is vital for the growth and maintenance of other tissues. IGF-I is also present in relatively large concentrations in the circulation of normal postpubertal individuals, although its precise function is not known. It appears likely that the primary source of circulating IGF-I is the liver, although the skeleton also contributes to total serum levels (5). Several studies have suggested that tissue levels of IGF-I reflect circulating concentrations (6, 7). For example, both cortical and trabecular content of IGF-I decline with age and with a slope that is nearly identical to the age-associated reduction in serum IGF-I (6, 7). Recently, we showed that serum IGF-I differs by almost 40% between two healthy inbred strains of mice (8, 9). The magnitude of this difference is similar to interstrain differences in skeletal content of IGF-I, and the production, in vitro, of IGF-I from neonatal calvarial cells (8, 9). Moreover, IGF-I and bone mineral density (BMD) cosegregate in progenitor crosses from these two inbred strains of mice, with serum IGF-I accounting for approximately 35% of the variance in femoral BMD among F2 mice (8, 9). Finally, we have also recently reported that middle-aged men with idiopathic osteoporosis (IOM) have low serum IGF-I concentrations (compared with age-matched controls), and that stimulatory GH dynamics in these men are normal (10, 11).
Based on these data, as well as evidence that serum IGF-I levels vary considerably in healthy free-living adults and work by Grogean et al. (12) and Comuzzie et al. (13) showing strong heritability for the IGF-I phenotype, we sought to test the hypothesis that serum IGF-I concentrations were associated with polymorphisms in the IGF-I gene. In this study we chose to examine the frequency in several cohorts of a highly polymorphic microsatellite composed of variable cytosine-adenosine (CA) repeats 1 kb upstream from the transcription start site of IGF-I.
| Methods |
|---|
|
|
|---|
A total of 171 Caucasian men and women were studied over the course of 2 yr. The groups were categorized by cohort according to location. The subjects reported in this manuscript belong to one of four distinct study groups. Each study was approved by the individual institutional review board (Columbia Presbyterian Medical Center, St. Joseph Hospital, McGuire Veterans Administration Hospital), and all subjects provided informed consent for the studies.
Subject categorization (Table 1
)
Group 1. Twenty-five men (mean age, 50.2 ±1.9 yr) from New York City recruited with IOM for a 2-yr randomized trial of human PTH were the initial group investigated for polymorphisms in the IGF-I gene. Characteristics of this cohort have been described in previous publications (9, 10).
|
Group 3. Thirty seven healthy ambulatory postmenopausal women (mean age, 72.3 ± 2.1 yr) from rural Maine involved in a calcium intervention (CAI) trial comprised the third group.
Group 4. The final cohort comprised 79 consecutive men and women (AP) (mean age, 58.6 ± 1.4 yr) referred to a cardiology practice for evaluation of chronic chest pain, some of whom had coronary artery disease but were otherwise healthy and were followed longitudinally for 6 months.
None of the subjects had medical diseases known to affect serum IGF-I or bone density. None were taking medications such as glucocorticoids, estrogen replacement, anticonvulsants, antiresorptive agents, fluoride, androgens, or GH. In addition, all subjects were ambulatory and had serum creatinine levels less than 1.5 mg/dL. None of the individuals had type I or type II diabetes mellitus or pituitary disease. None of the subjects was hospitalized within 3 months before obtaining blood samples. Dietary records were obtained and no subjects were noted to have low protein or calorie intake.
Serum IGF-I
Serum was obtained on 171 subjects in the fasting state and stored at -70 C. The RIA was performed using a double-antibody assay (supplied by Nichols Institute, San Juan Capistrano, CA) following acid-ethanol cryoprecipitation extraction to remove IGFBPs as reported previously (12). This method removes nearly all IGFBPs and correlates very closely with serum IGF-I measurements made after acid-gel chromatography separation (9, 12). All the samples were measured in duplicate by one technician at the laboratory of the Maine Center for Osteoporosis Research and Education. Assays were performed over a 2-yr period on freshly thawed samples, none of which had been stored for longer than 12 months at the time of defrosting. Based on our earlier studies in which we demonstrated that the RIA for IGF-I is not affected by sample age (i.e. <24 months and no previous thaw cycles), accuracy of the assay was not compromised by sample storage (12). Sample assays were run as batches for each cohort. However, to minimize interassay variation, samples from each cohort were measured in the ensuing assay. In addition, samples from the IOM cohort have been assayed twice yearly in follow-up and found to have an intrasubject variation of less than 10%. The detection limit of the IGF-I assay is 12 ng/mL. The inter- and intraassay coefficients of variation for IGF-I in our laboratory were 8.8% and 2.7%, respectively. There is less than 1% cross-reactivity with IGF-II or insulin in this assay. In the longitudinal studies from three cohorts (IOM, CAI, and AP), replicate serum IGF-I measurements changed less than 10% over 24 months. This is consistent with other recent studies showing minimal variation in serum IGF-I over time in the same individual (12, 14). The present study analyzes data from baseline samples only for subjects involved in longitudinal trials.
IGF-I genotyping
PCR was performed using oligonucleotide primers designed to amplify the polymorphic cytosine-adenine (CA)n repeat upstream of the transcription start site of the IGF-I gene (14, 15). The PCR primers were: 5' GCTAGCCAGCTGGTGTTATT; 3' ACCACTCTGGGAGAAGGGTA.
The primers were obtained from Research Genetics (Huntsville, AL). The location of the nucleotide position is 947984 in the original human IGF-I DNA sequence (Genbank accession number M12659, M77496).
Using standard proteinase K digestion and phenol/chloroform extraction,
genomic DNA was obtained from the buffy coats of whole blood samples.
Genotyping of the simple sequence (microsatellite) repeat in the IGF-I
locus used a slight modification of the published protocol by Weber and
May (16). One hundred nanograms template DNA, 0.25 µM
each primer, 200 µM each deoxynucleotide triphosphate,
1.5 mM MgCl2, 2% dimethyl sulfoxide, 1 U
Taq polymerase (Promega, Madison, WI), and manufacturers
recommended buffers were combined in 25-µl reactions. One primer was
radiolabeled with 32P using T4 polynucleotide kinase
(Pharmacia, Piscataway, NJ). For PCR amplification, 35 cycles were
performed. The initial temperature cycle for amplification was 94 C
denaturation for 45 sec, 70 C annealing for 30 sec, and 72 C extension
for 30 sec. The next 9 cycles each reduced the annealing temperature
1.0 C per cycle. This was followed by 25 additional cycles of 94 C for
35 sec, 61 C for 30 sec, and 72 C for 30 sec. The reaction was ended
with a final extension at 72 C for 5 min. Radiolabeled PCR products
were screened for length variation through electrophoresis in standard
denaturing polyacrylamide gels. Autoradiographs were exposed for 412
h in cassettes without intensifying screens. All genotypes were scored
by two independent investigators. The term 192 was used to
signify the 19 CA repeats (192 bp) as reported by Weber and May (16)
and labeled Z in their initial report. Other PCR product sizes ranging
from 188198 were given a number designated by the size of the CA
repeat (188198; Fig. 1
). Genotyping was
performed on 171 subjects.
|
BMD of the spine (L2-L4) and hip are reported for the two male studies (IOM and HM) and were performed using dual energy X-ray absorptiometry with the Hologic QDR-1000 DXA machine (Hologic Inc., Waltham, MA). Both are located at centers (College of Physicians and Surgeons, Columbia University and Medical College of Virginia) performing clinical trials that require daily phantom scanning and quality assurance. Precision errors for the various sites were as follows: lumbar spine 0.68%, femoral neck 1.3%, and distal radius 0.70%. T scores were reported as units of standard deviation from young male normals according reference data supplied by the manufacturer. The total hip was utilized for the femur studies to assure continuity in databases.
Statistical analysis
The Fishers exact test was employed to compare the difference in frequency of the 192/192 genotype in the IOM to the rest of the population under investigation. Ninety-five percent confidence intervals (CIs) are reported, and P < 0.05 was considered significant. An unpaired two-tailed Students t test was used to compare serum IGF-I levels between subjects possessing or not possessing the 192/192 genotype in the microsatellite CA repeat. Age and sex adjustments were performed on IGF-I values using linear regression analysis. A P value <0.05 was considered significant. The serum IGF-I levels were equally distributed across the cohorts except as reported for the men with IOM (10). However, BMD in the HM study revealed a tendency towards lower T scores in both the spine and hip than predicted from age-matched normals. Hence, BMD results are reported as median values with 95% CIs in parentheses. All other values are mean ± SEM.
| Results |
|---|
|
|
|---|
The mean serum IGF-I concentration in each cohort is noted in
Table 1
. The age range for subjects in these studies was 3588 yr. The
range of serum IGF-I was 35379 ng/mL. Serum IGF-I was negatively
associated with age in each cohort and for the combined population of
146 men and women (r = -0.75; P < 0.001). In the
largest trial of consecutively recruited men and women (AP), there was
an age-associated decline in serum IGF-I (n = 79; r = -0.55
P < 0.001; males: n = 59; r = -0.39,
P = 0.002; females: n = 20, r = -0.64,
P = 0.003). In this cohort, women had significantly
lower serum IGF-I levels than men (176 ± 5 ng/mL vs.
112 ± 8 ng/mL P = 0.0002).
As reported previously, subjects with IOM have low serum IGF-I levels
compared with normative values from our laboratory for men of this age
group (10, 12). Mean IGF-I levels in IOM also differed significantly
from the HM cohort in this study despite nearly identical ages (10, 12)
(Table 1
).
Allele frequencies in a dinucleotide repeat of IGF-I gene
To investigate the mechanism underlying the difference between IOM and HM, as well as the normal variation in IGF-I serum levels within human populations, we examined a polymorphic CA dinucleotide repeat 1 kb upstream of the IGF-1 transcription start site (15, 16). The most frequent allele in our population samples is 192 bp in length, which corresponds to the observations of Weber and May (16) in 1989. Among 146 subjects (cohorts HM, CAI, and AP) for 292 chromosomes, the allele frequencies for the 192 bp and 194 bp were 59% and 24%, respectively. Thirty-two were homozygous for the 192-bp allele (here designated 192/192) and 28% were heterozygous for the 192/194 alleles. Five percent were homozygous for the 194 allele.
In men with IOM, 16 of 25 (64%) were homozygous for the 192 allele. Thus, the frequency for the 192/192 genotype in IOM was twice that of other populations [frequency = 0.64 (IOM) vs. 0.32 (others); P < 0.004]. A similar relationship was noted when the frequency of the 192/192 genotype from the IOM cohort was compared with the frequency of 192/192 in only male subjects (P < 0.02).
Genotypes and serum IGF-I
Next we asked whether a single polymorphism within this
microsatellite of the IGF-I gene was associated with serum IGF-I
levels. First, among 116 consecutively recruited (AP and CAI) men
(n = 59) and women (n = 57), 30% (n = 37) possessed the
192/192 genotype. The mean serum IGF-I for those with the
192/192 genotype was significantly lower than subjects with
any other genotype [192/194, 194/194, 194/196, 192/188, or
192/190 (n = 79); 192/192, 129 ± 7
ng/mL vs. others, 154 ± 9 ng/mL; P =
0.03]. Similarly, in the AP cohort of consecutive men and women
(n = 79), serum IGF-I differed significantly by genotype:
192/192, 128.4 ± 9.8 vs. others, 162
± 9.3 ng/mL; P = 0.02 (Table 2
).
|
|
The most frequent heterozygous allele combination in all cohorts was the 192/194, which was present in 39/146 individuals. Differences in serum IGF-I levels were even more dramatic in the AP cohort when comparing the two most frequently observed genotypes: 192/192, 130.6 ± 10 ng/mL vs. 192/194, 185 ± 10 ng/mL; P < 0.001. Similarly, in the HM group, although the number of subjects was smaller and therefore the difference was not statistically significant, the 192/192 genotype had consistently lower serum IGF-I levels than 192/194: 192/192, 182 ± 17 ng/mL vs. 192/194, 220 ± 32 ng/mL.
Because gender and age were variables that affected serum IGF-I, and there was a wide age range of subjects recruited in these cohorts, we compared IGF-I data between men and women with the two most common genotypes (192/192 vs. 192/194) after adjusting for sex and age. Those subjects with the 192/192 genotype still had serum IGF-I levels 20% lower than those with 192/194 (P = 0.02).
IGF-I alleles and BMD
As shown above, males with IOM have low serum IGF-I levels and a
higher frequency of the 192/192 genotype. Therefore, we
examined whether healthy males from the HM cohort in Virginia who were
192/192 had reduced spine or hip BMDs compared with those
with any other genotype. Consistent with the 192/192
frequency observed for all non-IOM subjects, 12/30 males in this cohort
were 192/192. These men (Table 3
) had lower median BMD T scores at both
the spine and hip than did the other 18 men with various genotypes,
although the differences between the two did not quite achieve
statistical significance (P = 0.15).
|
| Discussion |
|---|
|
|
|---|
Several lines of evidence from this study support our working hypothesis. First, we noted that men with IOM and low serum IGF-I concentrations were twice as likely to be homozygous for a 192-bp allele in the IGF-I gene. Moreover, in 30 HM, the 192/192 genotype was also associated with decreased BMD at both the spine and hip and lower serum IGF-I levels than men with any other genotype. These findings imply that there is a relationship between this polymorphism and the bone density phenotype.
Second, we noted that homozygosity for the 192 allele is associated with low serum levels of IGF-I for both men and women even after correction for age and gender. In fact, among all men in this study possessing the 192/192 genotype, the mean serum IGF-I level was almost identical to those who suffered from IOM. Yet that concentration of IGF-I is almost 1 SD below age-adjusted means for healthy men (9, 10, 12). This difference in serum IGF-I could have implications in determining acquisition of peak bone mass. For example, in our studies of inbred strains of mice, interstrain differences in serum IGF-I of 30% were strongly correlated with differences of 30% in femoral BMD (8, 9). Further studies will be required to assess whether there is a causative relationship between serum IGF-I and peak bone mass in man. These findings could have major implications in terms of screening men for osteoporosis and for understanding the pathogenesis of this devastating disease.
Although our data suggest an association between low levels of IGF-I and a polymorphism in the IGF-I gene, the cause of this association is, at present, not clear. This particular microsatellite is located only 1 kilobase upstream from the transcription start site, and is known to contain specific regulatory elements (17). Therefore, it is conceivable that allelic variation in this region could lead to changes in a promoter, thereby altering transcription of IGF-I (18). Alternatively, this polymorphism may be in linkage disequilibrium with another sequence in or near a promoter where message stability, or the half-life of circulating IGF-I could be affected (19). Both these possibilities require further investigation but lend credence to the hypothesis that there are multiple non-GH regulators of IGF-I. For example, we have noted that GH secretion and nutritional determinants are normal in men with IOM (10, 11). These findings plus data generated from this study, could lead to identification of factors that control tissue-specific expression of IGF-I. Certainly, this has already been demonstrated for skeletal IGF-I, which is induced by PTH, and whose promoter region for cAMP is located very near the microsatellite reported in this study (17). Clearly, more studies will be needed to understand the genetic component of this relationship and its functional effects.
There are several limitations to this study. First, this is an association study and therefore a direct effect of IGF-I genotype on serum levels cannot be determined. Although the frequency distribution is suggestive, the number of subjects is still relatively small. Moreover, these cohorts could be unique and therefore may not be representative of the general population. For example, for men from Virginia, BMD at both the spine and hip were somewhat lower than predicted from age-adjusted T scores. This may be because of the relatively small data sets available for men, the small number of subjects we studied, or less likely, some environmental factor unique to these 30 healthy men. Conclusions about a relationship between homozygosity in the 192 allele and BMD or IGF-I must await further studies in larger popu-lations.
A second limitation is that we have so far studied only Caucasians who live on the east coast of the United States. Examination of other ethnic groups will be required to assess whether this relationship holds in other population groups. For example, African-American men have greater serum IGF-I levels and GH secretion than Caucasians (20). Also, there are measurable differences in body composition between Asians and Caucasians that could be related to expression of IGF-I. Therefore studies of this IGF-I polymorphism among different population groups may be partic-ularly illuminating.
More rigorous proof of the relationship between genotype and the IGF-I phenotype can come through more definitive linkage studies, especially among extended families and pedigrees. Larger studies are planned in homogenous populations in which environmental factors have been at least partially controlled.
Finally, we do not know whether differences in serum IGF-I can be related to tissue expression of this peptide. Clearly, most circulating IGF-I is derived from the liver, and other investigators have shown that alternative splicing in exon 1 can occur in extrahepatic tissues such as bone (18). Because we have excluded GH deficiency (by provocative testing) in the IOM cohort, it is conceivable that nonhepatic sources of IGF-I could contribute to the serum levels of IGF-I observed in this study. Still, a more intensive investigation of tissue-specific IGF-I expression, as well as examination of several IGFBPs that regulate IGF bioactivity, will be required to determine the significance of these findings at a tissue level.
In summary, we report that serum IGF-I levels are related to a polymorphism in a microsatellite within the IGF-I gene. The consequence of such an association may include differences in acquisition of BMD. Further studies are needed to define the role of this polymorphism in the expression of serum and tissue IGF-I levels.
Received January 26, 1998.
Revised March 2, 1998.
Accepted April 10, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Khosla, S. Amin, and E. Orwoll Osteoporosis in Men Endocr. Rev., June 1, 2008; 29(4): 441 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Siahpush, T. L. Vaughan, J. N. Lampe, R. Freeman, S. Lewis, R. D. Odze, P. L. Blount, K. Ayub, P. S. Rabinovitch, B. J. Reid, et al. Longitudinal Study of Insulin-like Growth Factor, Insulin-like Growth Factor Binding Protein-3, and their Polymorphisms: Risk of Neoplastic Progression in Barrett's Esophagus Cancer Epidemiol. Biomarkers Prev., November 1, 2007; 16(11): 2387 - 2395. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Hand, M. C. Kostek, R. E. Ferrell, M. J. Delmonico, L. W. Douglass, S. M. Roth, J. M. Hagberg, and B. F. Hurley Influence of promoter region variants of insulin-like growth factor pathway genes on the strength-training response of muscle phenotypes in older adults J Appl Physiol, November 1, 2007; 103(5): 1678 - 1687. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Estany, M. Tor, D. Villalba, L. Bosch, D. Gallardo, N. Jimenez, L. Altet, J. L. Noguera, J. Reixach, M. Amills, et al. Association of CA repeat polymorphism at intron 1 of insulin-like growth factor (IGF-I) gene with circulating IGF-I concentration, growth, and fatness in swine Physiol Genomics, October 19, 2007; 31(2): 236 - 243. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hovind, S. Lamberts, W. Hop, J. Deinum, L. Tarnow, H.-H. Parving, and J. A M J L Janssen An IGF-I gene polymorphism modifies the risk of developing persistent microalbuminuria in type 1 diabetes Eur. J. Endocrinol., January 1, 2007; 156(1): 83 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chen, R. Freeman, L. F. Voigt, A. Fitzpatrick, S. R. Plymate, and N. S. Weiss Prostate Cancer Risk in Relation to Selected Genetic Polymorphisms in Insulin-like Growth Factor-I, Insulin-like Growth Factor Binding Protein-3, and Insulin-like Growth Factor-I Receptor Cancer Epidemiol. Biomarkers Prev., December 1, 2006; 15(12): 2461 - 2466. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Landmann, F. Geller, J. Schilling, S. Rudloff, E. Foeller-Gaudier, and L. Gortner Absence of the Wild-type Allele (192 Base Pairs) of a Polymorphism in the Promoter Region of the IGF-I Gene but Not a Polymorphism in the Insulin Gene Variable Number of Tandem Repeat Locus Is Associated With Accelerated Weight Gain in Infancy Pediatrics, December 1, 2006; 118(6): 2374 - 2379. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Reeves, C. Meldrum, and R. J. Scott Re: IGF-1 Gene Polymorphism and Risk for Hereditary Nonpolyposis Colorectal Cancer. J Natl Cancer Inst, November 15, 2006; 98(22): 1664 - 1665. [Full Text] [PDF] |
||||
![]() |
C. Mau Kai, K. M. Main, A. Nyboe Andersen, A. Loft, M. Chellakooty, N. E. Skakkebaek, and A. Juul Serum Insulin-Like Growth Factor-I (IGF-I) and Growth in Children Born after Assisted Reproduction J. Clin. Endocrinol. Metab., November 1, 2006; 91(11): 4352 - 4360. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Delahunty, K. L. Shultz, G. A. Gronowicz, B. Koczon-Jaremko, M. L. Adamo, L. G. Horton, J. Lorenzo, L. R. Donahue, C. Ackert-Bicknell, B. E. Kream, et al. Congenic Mice Provide in Vivo Evidence for a Genetic Locus that Modulates Serum Insulin-Like Growth Factor-I and Bone Acquisition Endocrinology, August 1, 2006; 147(8): 3915 - 3923. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tsuchiya, L. Wang, H. Suzuki, T. Segawa, H. Fukuda, S. Narita, M. Shimbo, T. Kamoto, K. Mitsumori, T. Ichikawa, et al. Impact of IGF-I and CYP19 Gene Polymorphisms on the Survival of Patients With Metastatic Prostate Cancer J. Clin. Oncol., May 1, 2006; 24(13): 1982 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Cleveland, M. D. Gammon, S. N. Edmiston, S. L. Teitelbaum, J. A. Britton, M. B. Terry, S. M. Eng, A. I. Neugut, R. M. Santella, and K. Conway IGF1 CA repeat polymorphisms, lifestyle factors and breast cancer risk in the Long Island Breast Cancer Study Project Carcinogenesis, April 1, 2006; 27(4): 758 - 765. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zecevic, C. I. Amos, X. Gu, I. M. Campos, J. S. Jones, P. M. Lynch, M. A. Rodriguez-Bigas, and M. L. Frazier IGF1 Gene Polymorphism and Risk for Hereditary Nonpolyposis Colorectal Cancer J Natl Cancer Inst, January 18, 2006; 98(2): 139 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
K Iida, C J Rosen, C Ackert-Bicknell, and M O Thorner Genetic differences in the IGF-I gene among inbred strains of mice with different serum IGF-I levels J. Endocrinol., September 1, 2005; 186(3): 481 - 489. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sweeney, M. A. Murtaugh, K. B. Baumgartner, T. Byers, A. R. Giuliano, J. S. Herrick, R. Wolff, B. J. Caan, and M. L. Slattery Insulin-Like Growth Factor Pathway Polymorphisms Associated with Body Size in Hispanic and Non-Hispanic White Women Cancer Epidemiol. Biomarkers Prev., July 1, 2005; 14(7): 1802 - 1809. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Kostek, M. J. Delmonico, J. B. Reichel, S. M. Roth, L. Douglass, R. E. Ferrell, and B. F. Hurley Muscle strength response to strength training is influenced by insulin-like growth factor 1 genotype in older adults J Appl Physiol, June 1, 2005; 98(6): 2147 - 2154. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Mohan and D J Baylink Impaired skeletal growth in mice with haploinsufficiency of IGF-I: genetic evidence that differences in IGF-I expression could contribute to peak bone mineral density differences J. Endocrinol., June 1, 2005; 185(3): 415 - 420. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Morimoto, P. A. Newcomb, E. White, J. Bigler, and J. D. Potter Variation in Plasma Insulin-Like Growth Factor-1 and Insulin-Like Growth Factor Binding Protein-3: Genetic Factors Cancer Epidemiol. Biomarkers Prev., June 1, 2005; 14(6): 1394 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Donovan, D. Dempster, H. Zhou, D. J. McMahon, J. Fleischer, and E. Shane Low Bone Formation in Premenopausal Women with Idiopathic Osteoporosis J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3331 - 3336. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Morimoto, P. A. Newcomb, E. White, J. Bigler, and J. D. Potter Insulin-like Growth Factor Polymorphisms and Colorectal Cancer Risk Cancer Epidemiol. Biomarkers Prev., May 1, 2005; 14(5): 1204 - 1211. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Schildkraut, W. Demark-Wahnefried, R. M. Wenham, J. Grubber, A. S. Jeffreys, S. C. Grambow, J. R. Marks, P. G. Moorman, C. Hoyo, S. Ali, et al. IGF1 (CA)19 Repeat and IGFBP3 -202 A/C Genotypes and the Risk of Prostate Cancer in Black and White Men Cancer Epidemiol. Biomarkers Prev., February 1, 2005; 14(2): 403 - 408. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Veldhuis, J. N. Roemmich, E. J. Richmond, A. D. Rogol, J. C. Lovejoy, M. Sheffield-Moore, N. Mauras, and C. Y. Bowers Endocrine Control of Body Composition in Infancy, Childhood, and Puberty Endocr. Rev., February 1, 2005; 26(1): 114 - 146. [Abstract] [Full Text] [PDF] |
||||
![]() |
G S Bleumink, A F C Schut, M C J M Sturkenboom, J A M J L Janssen, J C M Witteman, C M van Duijn, A Hofman, and B H C. Stricker A promoter polymorphism of the insulin-like growth factor-I gene is associated with left ventricular hypertrophy Heart, February 1, 2005; 91(2): 239 - 240. [Full Text] [PDF] |
||||
![]() |
O. Fletcher, L. Gibson, N. Johnson, D. R. Altmann, J. M.P. Holly, A. Ashworth, J. Peto, and I. d. S. Silva Polymorphisms and Circulating Levels in the Insulin-Like Growth Factor System and Risk of Breast Cancer: A Systematic Review Cancer Epidemiol. Biomarkers Prev., January 1, 2005; 14(1): 2 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Wong, K. DeLellis, N. Probst-Hensch, W.-P. Koh, D. Van Den Berg, H.-P. Lee, M. C. Yu, and S. A. Ingles A New Single Nucleotide Polymorphism in the Insulin-Like Growth Factor I Regulatory Region Associates with Colorectal Cancer Risk in Singapore Chinese Cancer Epidemiol. Biomarkers Prev., January 1, 2005; 14(1): 144 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tran, B. S. Bharaj, E. P. Diamandis, M. Smith, B. D. L. Li, and H. Yu Short Tandem Repeat Polymorphism and Cancer Risk: Influence of Laboratory Analysis on Epidemiologic Findings Cancer Epidemiol. Biomarkers Prev., December 1, 2004; 13(12): 2133 - 2140. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. DeLellis, S. Rinaldi, R. J. Kaaks, L. N. Kolonel, B. Henderson, and L. Le Marchand Dietary and Lifestyle Correlates of Plasma Insulin-Like Growth Factor-I (IGF-I) and IGF Binding Protein-3 (IGFBP-3): The Multiethnic Cohort Cancer Epidemiol. Biomarkers Prev., September 1, 2004; 13(9): 1444 - 1451. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Slattery, W. Samowitz, K. Curtin, K. N. Ma, M. Hoffman, B. Caan, and S. Neuhausen Associations among IRS1, IRS2, IGF1, and IGFBP3 Genetic Polymorphisms and Colorectal Cancer Cancer Epidemiol. Biomarkers Prev., July 1, 2004; 13(7): 1206 - 1214. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gennari, L. Masi, D. Merlotti, L. Picariello, A. Falchetti, A. Tanini, C. Mavilia, F. Del Monte, S. Gonnelli, B. Lucani, et al. A Polymorphic CYP19 TTTA Repeat Influences Aromatase Activity and Estrogen Levels in Elderly Men: Effects on Bone Metabolism J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2803 - 2810. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Lai, D. Vesprini, W. Zhang, M. J. Yaffe, M. Pollak, and S. A. Narod A Polymorphic Locus in the Promoter Region of the IGFBP3 Gene Is Related to Mammographic Breast Density Cancer Epidemiol. Biomarkers Prev., April 1, 2004; 13(4): 573 - 582. |