The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 1 116-123
Copyright © 2000 by The Endocrine Society
Genotype/Phenotype Correlation of Multiple Endocrine Neoplasia Type 1 Gene Mutations in Sporadic Gastrinomas
Stephan U. Goebel,
Christina Heppner,
A. Lee Burns,
Stephen J. Marx,
Allen M. Spiegel,
Zhengping Zhuang,
Irina A. Lubensky,
Fathia Gibril,
Robert T. Jensen and
José Serrano
Digestive Diseases Branch (S.U.G., F.G., R.T.J., J.S.) and the
Metabolic Diseases Branch (C.H., A.L.B., S.J.M., A.M.S.), National
Institute of Diabetes and Digestive and Kidney Diseases, and the
Laboratory of Pathology, National Cancer Institute (Z.Z., I.A.L.),
National Institutes of Health, Bethesda, Maryland 20892
Address all correspondence and requests for reprints to: Dr. Robert T. Jensen, Digestive Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Building 10, Room 9C-103, 10 Center Drive, MSC 1804, Bethesda, Maryland 20892-1804.
 |
Abstract
|
|---|
Multiple endocrine neoplasia type 1 (MEN1) gene mutations are reported
in some gastrinomas occurring in patients without MEN1 as well as in
some other pancreatic endocrine tumors (PETs). In some inherited
syndromes phenotype-genotype correlations exist for disease severity,
location, or other manifestations. The purpose of the present study was
to correlate mutations of the MEN1 gene in a large
cohort of patients with sporadic gastrinomas to disease activity, tumor
location, extent, and growth pattern. DNA was extracted from frozen
gastrinomas from 51 patients and screened by dideoxyfingerprinting
(ddF) for abnormalities in the 9 coding exons and adjacent splice
junctions of the MEN1 gene. Tumor DNA exhibiting
abnormal ddF patterns was sequenced for mutations. The findings were
correlated with clinical manifestations of the disease, primary tumor
site, disease extent, and tumor growth postoperatively. Tumor growth
was determined by serial imaging studies. Sixteen different
MEN1 gene mutations in the 51 sporadic gastrinomas
(31%) were identified (11 truncating, 4 missense, and 1 in-frame
deletion). Nine of the 16 mutations were located in exon 2 compared to
7 of 16 in the remaining 8 coding exons (P = 0.005
on a per nucleotide basis). Primary pancreatic or lymph node
gastrinomas with a mutation had only exon 2 mutations, whereas duodenal
tumors uncommonly harbored exon 2 mutations (P =
0.011). Similarly, small primary tumors (<1 cm) more frequently
contained a nonexon 2 mutation (P = 0.02). There
was no difference between patients with or without a mutation with
respect to clinical characteristics, primary tumor site, disease
extent, or proportion of patients disease free after surgery.
Postoperative tumor growth tended to be more aggressive in patients
with a mutation (P = 0.09). No correlation in the
rate of disease-free status or postoperative tumor growth in patients
with active disease to the location of the mutation was seen. These
results demonstrate that the MEN1 gene is mutated in
31% of sporadic gastrinomas, and mutations are clustered between amino
acids 66166, which differs from patients with familial MEN1, in whom
mutations occur throughout the gene. The presence of an
MEN1 gene mutation does not correlate with clinical
characteristics of patients with gastrinomas, gastrinoma extent, or
growth pattern; however, the location of the mutation differed with
gastrinoma location. These data suggest that mutations in the
MEN1 gene are important in a proportion of sporadic
gastrinomas, but the presence or absence of these mutations will not
identify the clinically important subgroups with different growth
patterns.
 |
Introduction
|
|---|
SINCE THE advent of effective gastric
antisecretory drug treatment, the natural history of patients with
sporadic Zollinger-Ellison syndrome has undergone a major change
(1, 2, 3). Long term survival is now primarily governed by the tumor
growth pattern and by its effective treatment, as opposed to the
complications of only the ulcer disease that previously determined the
clinical course (1, 2, 3). From recent studies (3, 4, 5, 6) it has become
evident that about 40% of the patients undergoing a gastrinoma
resection will remain permanently disease free, whereas 25% will
experience a malignant course and may ultimately die from the tumor.
Therefore, factors that determine the variable growth behavior of these
tumors will have an increasingly important effect on the survival of
patients with gastrinomas (3, 7). However, our understanding of the
molecular changes that form the basis for this variability in growth is
only rudimentary (7). For instance, the cell of origin of gastrinomas
has not yet been identified, and recent speculations indicate that
sporadic gastrinomas in different locations may actually originate from
several different cell types (8). Furthermore, the primary site and the
size of the primary tumor have been shown to be important determinants
of the growth pattern (4, 9); however, the molecular basis for this
remains unclear. Few studies of molecular abnormalities have shown
convincing evidence for a pathogenic role in tumorigenesis in sporadic
gastrinomas (7). Alterations of the ras oncogene, loss of
heterozygosity at the Rb locus, or mutations of the
p53 gene, which are important in the pathogenesis of many
tumors, are rarely found in sporadic gastrinomas, other pancreatic
endocrine tumors, or carcinoid tumors (7, 10, 11, 12). Amplification of the
HER-2/neu protooncogene was found in virtually every
gastrinoma in a small series (10); however, no data regarding protein
expression or pathogenic mechanism were elucidated. The autosomal
dominant syndrome multiple endocrine neoplasia type 1 (MEN1) is present
in 25% of patients with gastrinomas. MEN1 is caused by mutations in a
10-exon gene on chromosome 11q13, resulting in alterations in the
predicted 610-amino acid protein, menin (13, 14). Recent studies
involving small numbers of pancreatic endocrine tumors and gastrinomas
occurring in patients without MEN1 (15, 16, 17) suggest that mutations in
the MEN1 gene occur in a proportion of these patients and
therefore are probably important in their pathogenesis. In some
inherited syndromes caused by alterations in tumor suppressor genes or
oncogenes or in their sporadic counterparts, genotype/phenotype
associations have been described (18), where different mutations affect
disease severity, prognosis, or clinical expression. The existence of
such relationships in patients with gastrinomas would have a profound
effect on clinical management; however, it is presently unknown whether
similar relationships exist in the case of mutations of the
MEN1 gene in patients with sporadic gastrinomas. The purpose
of the present study was, therefore, to correlate mutations of the
MEN1 gene in a large cohort of patients with sporadic
gastrinomas to clinical manifestations of gastrinomas, tumor location,
extent, and growth pattern.
 |
Materials and Methods
|
|---|
Patients and tumors
Fifty-one patients who underwent exploratory laparotomy for
Zollinger-Ellison syndrome at the NIH between 1990 and 1998 were
included in this study. The diagnosis of Zollinger-Ellison syndrome was
established as previously reported (19), using measurements of fasting
gastrin levels, basal acid output, secretin and calcium-provocative
tests, and histological results. Patients with MEN1, diagnosed by
family history or laboratory evidence of other endocrinopathies,
determined as described previously (20), were excluded from the study.
The study protocol was approved by the institutional review board of
the NIDDK, and all patients gave informed consent.
To determine correlations of genetic alterations with clinical,
laboratory, and tumor characteristics (growth, location, and size), the
results from the following investigations performed on all patients
were assessed. Measurement of basal acid output (BAO) and maximal acid
output were performed as previously described (21). Fasting serum
gastrin levels were determined in all patients and analyzed by RIA
(Bioscience Laboratories, New York, NY) or Mayo Clinic Laboratories
(Rochester, MN). The duration of disease determined in all patients was
defined from the time of diagnosis or from the time of disease onset,
as previously described (4). Detailed conventional imaging studies
(computed tomography with oral and iv contrast, magnetic resonance
imaging, ultrasound, selective abdominal angiography with secretin
stimulation, and hepatic vein gastrin sampling) and somatostatin
receptor scintigraphy were performed as previously reported (5, 22, 23)
to locate the primary tumor and evaluate the extent of disease. All
patients underwent exploratory laparotomy with an extensive
intraoperative evaluation for attempted curative resection (5, 24). The
patients were then reassessed within 2 weeks of surgery and 36 months
postoperatively to determine disease-free status and annually to
monitor progression of disease, as previously described (19).
Disease-free status was defined by normal fasting gastrin levels (<200
pg/mL), negative results on gastrin provocative testing with secretin
(<200 pg/mL increase) and calcium (<395 pg/mL increase), and no
evidence of tumor on any imaging study (19, 25). Patients were
classified as to whether they were disease free immediately
postoperatively and at the last follow-up. In those patients who were
not disease free postoperatively, annual detailed imaging studies
(computed tomography, magnetic resonance imaging, ultrasound, and
somatostatin receptor scintigraphy) provided the basis for assessment
of tumor growth. Consistent absence of imagable lesions or lack of
increase in size or number of lesions over the follow-up period was
defined as a tumor not demonstrating growth. An increase in the size or
number of lesions on imaging studies was defined as evidence of tumor
growth. The new development of liver metastases during follow-up served
as the definition for the liver metastases group.
Mutation analysis
Twenty-four patients had not had the MEN1 status of their
gastrinomas previously assessed, and this was determined as described
below. In 27 patients the MEN1 mutation status was known and previously
reported (15); however, in that study no correlations with tumor
phenotype genotype expression were performed. Tumor samples were
immediately snap-frozen in liquid nitrogen during surgery and stored at
-70 C. Tumor DNA was extracted from 8-µm cryosections of the
specimens using a commercial kit (QiAamp blood kit,
QIAGEN, Santa Clarita, CA) after analyzing an adjacent
slide with hematoxylin and eosin staining to determine that there was
no gross contamination with normal tissue. Germline DNA was extracted
from leukocytes of these patients using the same kit.
Primers for amplification of exons 210 of the MEN1 gene
were obtained according to the published sequences
(http://www.nhgri.nih.gov). PCR was carried out in a final volume
of 25 µL with 510 ng DNA and 0.5 µU DNA-polymerase (AmpliTaq
Gold, Perkin-Elmer Corp., Foster City, CA) according to
the manufacturers protocol. Dimethylsulfoxide in a final
concentration of 5% was added to the PCR reactions for exons 2, 9, and
10. The PCR reaction was run under the following conditions: initial
denaturation at 94 C for 10 min; 35 cycles of 94 C for 30 s, 60 C
for 30 s, and 72 C for 2 min; and final extension at 72 C for 5
min in a thermal cycler (Perkin-Elmer Corp., 9600
thermocycler). PCR products were then subjected to
dideoxyfingerprinting (ddF) as previously reported (26) using
previously described primers (http://www.nhgri.nih.gov). The ddF
reactions were run in nondenaturing gels (MDE, FMC Bioproducts,
Rockland, ME) at 8 watts for 8 h. Subsequently, the gels were
dried, and autoradiography was performed overnight. Samples with
abnormal ddF patterns were subjected to direct sequencing using the
same PCR primers and ddF primers for manual (AmpliCycle,
Perkin-Elmer Corp.) and automated (ABI Prism, Perki- Elmer Corp.) sequencing. For those samples in which the mutated
sequence could not be unambiguously identified on the sequencing gel,
the primary PCR product was cloned in the vector pCR2.1 (TA-Cloning,
Invitrogen, Carlsbad, CA) and resequenced.
Statistics
The
2 test, Fishers exact test ,and
Mann-Whitney rank test were used to compare the effects of
MEN1 gene mutations on clinical and laboratory parameters
and tumor characteristics. P < 0.05 was considered
significantly different.
 |
Results
|
|---|
A total of 51 gastrinomas from 51 patients were studied. Clinical
characteristics and laboratory values of the patients are shown in
Table 1
. This cohort is similar to other
large series (2, 27, 28, 29) with respect to a slight male preponderance
(57%), mean age of the patients (50 yr), and duration of disease, as
defined by the time from onset of continuous symptoms until the surgery
date (9 yr). Mean serum gastrin, preoperative BAO, and maximal acid
output values are not significantly different from those in other large
studies of patients with Zollinger-Ellison syndrome (29). Inhibition of
gastric acid production at the time of surgery was achieved
predominantly with
H+-K+-adenosine
triphosphatase inhibitors (omeprazole 45, lansoprazole 1). In contrast
to older series (1, 2, 30, 31), but similar to other recent studies
(32, 33), half of all identified primary tumors were located in the
duodenum, and only 15% were found in the pancreas. The extent of the
tumor encountered during surgery was comparable to that in other large
surgical series (2), in that one third were confined to the primary
site, another 33% included the primary site and spread to the lymph
nodes, and only 8% had evidence of liver metastases during
surgery.
When tumor DNA was extracted from frozen tissue and analyzed by ddF and
direct sequencing for mutations in the 9 coding exons and splice
junctions of the MEN1 gene, we found 16 mutations in the 51
tumors examined (Fig. 1
, left). No
mutations were found in the corresponding leukocyte DNA. The mutations
consisted of 2 nonsense, 4 missense (all leading to nonconservative
amino acid changes), 9 deletions leading to frame shifts, and one
in-frame deletion of 10 amino acids. Figure 2
shows examples of a single base substitution leading to a nonsense
mutation and a single base deletion leading to a frame shift. In Fig. 2a
(top panel), the antisense strand of the mutation R98X
(CGA->TGA) is shown in the gastrinoma tissue. The heterozygous state
is due to amplification of the normal sequence from contaminating
normal tissue, seen in the same patients leukocyte DNA (Fig. 2a
, top panel). The antisense strand of the mutation 512delC in
a gastrinoma is depicted in Fig. 2b
(bottom panel). Figure 3
shows a complex substitution detected by
cloning of the normal and mutated allele (306AGCCCC
T). Three of the
16 mutations detected in our study have been previously found in the
germline of familial MEN1 [R98X (34), 512delC (35), and 483delAT
(36)]. Nine of the 16 mutations were located in exon 2, whereas the
remaining 7 mutations were distributed throughout the other 8 coding
exons (Fig. 1
, left). This represents a significant
overrepresentation of mutations per nucleotide (9 of 445 vs.
7 of 1381 nucleotides; P = 0.005) in exon 2.
Furthermore, 11 of 16 (68%) mutations were found in the gene region
encoding amino acids 66166 (exons 23) of the 610-amino acid protein
menin. We encountered several previously recognized polymorphisms
[R171Q, 7656(C
T), 102312(A
C), D418D, and A541T]. These
polymorphisms include the three most common polymorphisms (35) found in
familial MEN1.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 1. Somatic mutations of the MEN1
gene in gastrinomas. The 10 exons of the MEN1 gene are
shown diagrammatically. On the right the mutations
reported by Wang et al. (17 ), regardless of type of
mutation, are shown, and on the left the mutations found
in this study are depicted. The mutation nomenclature follows standard
reports (66 ). Deletions are numbered after the first deleted
nucleotide, whereas amino acid changes are numbered after the
respective codon. Deleted nucleotides are: 357del4,
CTGT; 358del25, TGTCTATCATCGCCGCCCTCTATGC;
1212del7, GCCAATG; and 1733del30,
AGCATCACCACCGCCGGAGGGTCCAGTGCT.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
Figure 2. Sequence analysis of tumor DNA and
corresponding leukocyte DNA from two gastrinoma patients showing two
different somatic mutations (a base substitution or deletion) of the
MEN1 gene. In the top panel (a), a single
C for T substitution results in a nonsense mutation(CGA TGA; R98X;
antisense strand shown) is seen in the gastrinoma
(arrow), but not in the leukocytes. In the bottom
panel (b), the gastrinoma shows a single base deletion, 512delC
(antisense strand shown), which is not seen in the leukocytes. Both
tumor specimens show the mutated as well as faintly the normal allele,
reflecting the presence of some normal tissue in the tumors.
|
|

View larger version (59K):
[in this window]
[in a new window]
|
Figure 3. Sequence analysis (antisense strand) from
two clones showing the normal sequence (A) and in the gastrinoma a
complex substitution (B; 306AGCCCC T).
|
|
To assess a possible effect of the presence of a mutation in the
MEN1 gene in patients with Zollinger-Ellison syndrome, we
compared first the clinical characteristics and expressions of
gastrinoma activity (gastrin level, gastrin change with secretin, and
BAO) of patients with or without a MEN1 gene mutation in the
gastrinoma (Table 2
). No significant
difference between the 2 groups was found regarding gender, age at
surgery, or duration of disease determined from the time of diagnosis
or from the onset of disease. Functional measures of the gastrinoma,
including fasting serum gastrin level, the magnitude of the serum
gastrin increase postsecretin, and the preoperative basal acid output,
were not significantly different in the 2 groups. A similar analysis
was performed to determine whether the presence or absence of a
MEN1 gene mutation in the gastrinoma varied with primary
tumor location or size, tumor extent, curability, or tumor growth
pattern (Table 3
). The primary tumor site
was located most often in the duodenum in both groups (43%
vs. 62%; Table 3
), and the frequencies of the primary tumor
location did not differ between the 2 groups. Although the resected
tumors with mutations tended to be somewhat smaller in size than the
tumors without a mutation, this difference did not reach statistical
significance [50% vs. 26% (<1 cm); P =
0.08; Table 3
]. Similarly, the tumor extent found intraoperatively did
not differ between the 2 groups. Specifically, a similar proportion of
patients had primary tumor only, lymph node metastases, or liver
metastases found at surgical exploration (Table 3
). Initially, more
than half of all patients were disease free postresection in both
groups (63% vs. 51%; Table 3
). After a mean follow-up of
3.1 ± 0.5 yr, a similar proportion of patients (44%
vs. 46%) remained disease free in both groups. The
postoperative course in the patients with active disease showed a trend
toward a more aggressive form, with evidence of tumor growth or
development of new liver metastases in the group with a MEN1
mutation in the gastrinoma. However, this finding did not reach a
statistically significant level (5 of 9 = 56% vs. 4 of
19 = 21%; P = 0.094).
View this table:
[in this window]
[in a new window]
|
Table 3. Comparison of tumor characteristics, results of
surgery, and postoperative course in patients with or without mutations
of the MEN1 gene in the gastrinoma
|
|
As the majority of mutations was located in exon 2 of the
MEN1 gene (Fig. 1
), we sought to analyze the tumor
characteristics in those patients with such a mutation compared to
those in patients with mutations at other locations (Table 4
). Primary duodenal tumors more
frequently had a nonexon 2 mutation (7 of 10) compared to pancreatic
and lymph node primary tumors (0 of 5; P = 0.011).
Nonexon 2 tumors were more frequently small in size (i.e.
<1 cm; 6 of 7) compared to tumors with an exon 2 mutation (2 of 9;
P = 0.02; Table 4
). However, there was no difference in
the rate of disease-free patients or the postoperative tumor growth
pattern in the patients with active disease with or without exon 2
mutations.
 |
Discussion
|
|---|
The hereditary syndrome MEN1 is characterized by the occurrence of
primary hyperparathyroidism (9598%), pancreatic endocrine tumors
(80100%), pituitary adenomas (6100%), gastric carcinoid tumors
(1330%), skin lesions (688%), and other, rarer, tumors (37, 38).
The gene responsible for the familial syndrome was recently cloned and
shown to be a 10-exon gene coding for the 610-amino acid protein menin,
whose function remains unclear (13, 14). Mutations in the 9 coding
exons or adjacent splice junctions have been identified in 7595% of
patients with familial MEN1 (fMEN1) (14, 34, 35, 39).
In tumors from patients without a hereditary tumor syndrome (sporadic
disease), Knudsons two-hit model of tumorigenesis postulates a
somatic mutation of a tumor suppressor gene and somatic loss of the
second allele via chromosomal breakage (40) or some other mechanism.
Studies in parathyroid adenomas from patients without MEN1 show a
frequency of somatic mutations of the MEN1 gene of 1321%
(41, 42). Sporadic pituitary adenomas only rarely (<5%) are found to
harbor MEN1 gene mutations (43, 44). Previous studies of
sporadic pancreatic endocrine tumors demonstrate somatic mutations in
the MEN1 gene in 2739% of the tumors (15, 16, 17). In keeping
with the published frequency of somatic mutations in pancreatic
endocrine tumors, we found 16 mutations in the MEN1 gene in
sporadic gastrinomas from 51 patients (31%). Despite a reportedly high
rate of loss of heterozygosity (93%) involving the MEN1
gene region in sporadic gastrinomas (15), we found no mutations in 35
gastrinomas. Several reasons can be hypothesized to explain this
finding. First, it could be proposed that the screening methodology
used lacks sensitivity. We employed ddF as the screening methodology.
This technique has a reported sensitivity of more than 90% for
detection of germline mutations (35), which is higher than the reported
sensitivity of single strand conformation polymorphism to detect single
base substitutions (80%) (45) that was used in a previous study (17).
Moreover, in one study, direct sequencing of the entire open reading
frame, albeit in a small number of sporadic pancreatic endocrine
tumors, did not increase the rate of detected mutations in the
MEN1 gene (16). Secondly, it is known that PCR-based
strategies for mutational analysis can underestimate the rate of large
deletions within a gene, i.e. deletion of the entire
MEN1 gene, as has been reported in one family with MEN1
(46). A third reason could be the inactivation of gene expression by
hypermethylation of the promotor region, as described in several other
tumor suppressor genes (47, 48). This alteration would not be detected
by the methodology used. Lastly, intron-based mutations may interfere
with ribonucleic acid splicing or stability and reduce translational
efficiency. However, the rate of detected mutations in this and recent
(15, 17) studies confirms that the MEN1 gene probably plays
a critical role in the pathogenesis of at least one third of sporadic
gastrinomas.
A comparison of type and location of mutations in the MEN1
gene detected in sporadic gastrinomas in the present study and in other
recent studies (15, 17) reveals a difference in the spectrum of
mutations in the sporadic disease from that found in the MEN1 syndrome.
Combining our data with results taken from the literature of other
cases of sporadic gastrinomas (17), 40% of the 28 mutations described
(8 missense and 3 in-frame deletions) are predicted to alter the amino
acid sequence of menin. All amino acid substitutions were
nonconservative. Seventeen mutations in sporadic gastrinomas are
predicted to result in a truncated protein (60% of the total). The
majority of mutations in fMEN1 lead to a truncated menin protein [103
of 141 (73%) germline mutations] (34, 35, 39) and probably loss of a
functional protein. None of the observed missense mutations involves
either of the two nuclear localization signals at the carboxyl-terminal
end of the protein (47). Menin has been shown to interact with the
transcription factor Jun-D (49). All missense mutations and in-frame
deletions except two (1733del30 and S543L) are located in the putative
menin binding region to Jun-D (0323 amino acids) as found on deletion
analysis (49) and conceivably could alter the interaction between these
2 proteins. The majority of all mutations in sporadic gastrinomas were
located in the 5'-end of the coding region. In the nucleotide stretch
from 300610 (exons 23), corresponding to amino acids 66166, we
found 64% of the mutations compared to 36% in the remaining 1516
nucleotides. In contrast, the mutations in patients with fMEN1 are
distributed rather evenly throughout the open reading frame regardless
of the presence or absence of gastrinoma (35). It is conceivable that
mutations involving the 3'-end of the coding region could lead to an
abnormal protein that retains some wild-type function and may be less
likely to promote tumorigenesis in sporadic gastrinomas. In fact, 6 of
the 11 mutations leading to an intact protein with an altered amino
acid sequence are within this region, possibly interfering with binding
properties to potential interaction partners. Whether the clustering of
mutations in this region is relevant for functional impairment of the
menin protein in sporadic gastrinomas awaits further analysis of
protein function.
Gastrinomas are not a homogeneous group of tumors. Not only do they
differ in the primary location (duodenal, pancreas, and other sites),
but also in clinical behavior, biological behavior, and growth pattern
(25% pursue an aggressive course) (2, 3, 4, 50). Even in patients with
liver metastases from progressive gastrinomas, the growth patterns are
highly variable (50, 51), with 30% demonstrating no or minimal tumor
growth, 30% having slow growth, and 40% having aggressive growth. The
factors contributing to these different phenotypes are largely unknown.
Genotype/phenotype correlations in hereditary tumor syndromes and a few
sporadic tumors have at times suggested a relationship between the type
or location of the mutation and the severity of the clinical disease or
clinical expression of the disease. Examples of such associations in
hereditary tumor syndromes have been described for MEN2 and
neurofibromatosis type 2 (NF2) (18, 52). Specifically, mutations in the
RET protooncogene are responsible for several different
inherited tumor syndromes. Familial MEN2A and familial medullary
thyroid cancer are usually caused by a mutation of one of five
different codons coding for cysteine residues in exon 10 or 11 (18).
Among these mutations, a mutation of codon 634 confers a higher risk of
developing pheochromocytomas and hyperparathyroidism (18, 53).
Furthermore, in patients with MEN2B, which is most frequently caused by
the specific mutation M918T in exon 16 (54), a clinically more
aggressive form of medullary thyroid cancer occurs than in MEN2A or
familial medullary thyroid cancer. Thus, evidence of such a mutation in
a patient with an inherited form of medullary thyroid cancer confers a
higher risk of an aggressive course of the disease. Similarly, in NF2,
truncating mutations of the NF2 gene are associated with a
more severe disease phenotype (earlier onset and multiple tumors)
compared to nontruncating mutations (52, 55). In other hereditary
cancer syndromes (breast cancer and hereditary nonpolyposis colon
cancer), no correlation between genotype and disease severity has been
established (56, 57). In fMEN1, to date, no correlation between the
location of the mutation or the type of mutation and clinical phenotype
or severity of disease has been found (34, 35, 39). Our data suggest
that there may be at least one genotype/phenotype correlation in
sporadic gastrinomas. Comparison of the primary tumor site to location
of the mutation revealed that nonduodenal primary tumors harbored only
exon 2 mutations, whereas only 30% of the duodenal tumors did. This
conclusion is based on relatively small numbers of gastrinomas
(i.e. n = 16) and will need to be confirmed by larger
studies in the future. This result is corroborated by the finding that
75% of the larger (>1-cm) primary tumors had an exon 2 mutation. As
duodenal tumors are commonly small (<1 cm), and nonduodenal primary
tumors are usually larger than 1 cm (2, 4, 5, 9), these results
together suggest a relationship between the site of the MEN1
gene mutation and the location of the sporadic primary tumor.
In a few instances specific mutations of a gene thought to be involved
in tumorigenesis of sporadic tumors correlate with the severity of the
clinical disease (58, 59, 60, 61, 62). Hence, detection of such a mutation may
serve as a prognostic marker and modify therapeutic strategies. In our
study the presence of a mutation in the MEN1 gene in
sporadic gastrinomas did not influence the rate patients were rendered
disease free after surgery or the rate of tumor growth, although a
trend toward a more aggressive course in the patients with active
disease was observed (P = 0.09). Future studies
involving a large number of patients and a long duration of follow-up
may provide confirmation of this trend. Moreover, the type of mutation
(data not shown) or location of the MEN1 gene mutation did
not correlate with the rate of tumor growth. Therefore, no prediction
about tumor extent or the postoperative growth behavior of the tumor
could be made from MEN1 gene mutational analysis of the
resected tumor. In contrast, analysis of the RET
protooncogene in sporadic medullary thyroid carcinoma shows the
mutation M918T to be present in 2045% of the tumors and to be
associated with a poor prognosis (58, 59, 60). Amplification of the
N-myc gene in sporadic neuroblastomas appears to be a
power-ful predictor of poor prognosis (61). In sporadic
vestibular schwannomas, mutations of the NF2 gene are
demonstrated in a similar frequency as MEN1 gene mutations
in gastrinomas (38%) (62). Furthermore, the spectrum of mutations with
regard to location or type of mutation is somewhat different from the
reported germline mutations in NF2, analogous to our observations in
the MEN1 gene. When the researchers attempted to correlate
the presence of a mutation, location, or type of mutation to growth
characteristics of the tumors, as measured by a calculated growth index
or proliferating cell nuclear antigen immunostaining, no strong
evidence for a correlation was found (62).
The reasons for the lack of correlation between the presence or site of
a MEN1 gene mutation and the severity of disease in sporadic
gastrinomas may be severalfold; sporadic gastrinomas, albeit clinically
a biochemically homogenous syndrome, display a variable clinical course
(2, 3, 9, 50) and thus may represent the common clinically apparent end
point of diseases of various etiologies. This is underscored by the
recently proposed concept of different embryonal origins of gastrinomas
from different locations (8). Hence, different molecular alterations in
the various cells of origin may lead to the common end point, a tumor
secreting gastrin, and thereby differentially influence tumor growth
patterns. Secondly, tumorigenesis has been proposed to be a multistep
process, as exemplified in the colon cancer model (63), involving
several successive molecular alterations that lead to the development
of a tumor. Analogous to the colon cancer model, the frequency of
mutations in the MEN1 gene in sporadic gastrinomas would
suggest a possible role early in tumor development, but probably
requires other genetic hits to explain the progression from the to date
unknown progenitor cell to a gastrinoma. As an extension to this idea,
a mutation of the MEN1 gene may promote the development of a
sporadic gastrinoma, but factors further downstream in the evolution of
the tumor may be responsible for the phenotypic expression of the
disease, i.e. extent or metastases.
In summary, we find that the MEN1 gene is mutated in one
third of sporadic gastrinomas. These mutations are clustered between
nucleotides 300610, in contrast to the finding in fMEN1, where they
are more evenly distributed throughout the exons. The presence of a
MEN1 gene mutation does not correlate with clinical
characteristics, tumor extent, or growth behavior of the gastrinoma;
however, there was a statistically significant correlation between the
location of the MEN1 gene mutation and the primary
gastrinoma location. Therefore, although the study confirms the
importance of MEN1 gene mutations in sporadic gastrinomas,
we could not establish a predictive value in the detection of a
mutation regarding tumor growth patterns, which is one of the most
important correlations that would directly affect clinical management
(2, 4, 7, 50, 64, 65). Such predictive factors may arise from further
understanding of the molecular steps involved in the pathogenesis of
these tumors.
Received June 16, 1999.
Revised August 30, 1999.
Accepted September 1, 1999.
 |
References
|
|---|
-
Ellison EH, Wilson SD. 1964 The
Zollinger-Ellison syndrome: re-appraisal and evaluation of 260
registered cases. Ann Surg. 160:512530.[Medline]
-
Jensen RT, Gardner JD. 1993 Gastrinoma. In: Go
VLW, DiMagno EP, Gardner JD, Lebenthal E, Reber HA, Scheele GA, eds.
The pancreas: biology, pathobiology and disease. New York: Raven Press;
931978.
-
Yu F, Venzon DJ, Serrano J, et al. 1999 Prospective study of the clinical course, prognostic factors and
survival in patients with longstanding Zollinger-Ellison syndrome. J Clin Oncol. 17:615630.[Abstract/Free Full Text]
-
Weber HC, Venzon DJ, Lin JT, et al. 1995 Determinants of metastatic rate and survival in patients with
Zollinger-Ellison syndrome: a prospective long-term study. Gastroenterology. 108:16371649.[CrossRef][Medline]
-
Alexander HR, Fraker DL, Norton JA, et al. 1998 Prospective study of somatostatin receptor scintigraphy and its effect
on operative outcome in patients with Zollinger-Ellison syndrome. Ann
Surg. 228:228238.[CrossRef][Medline]
-
Norton JA, Doppman JL, Jensen RT. 1992 Curative
resection in Zollinger-Ellison syndrome: results of a 10-year
prospective study. Ann Surg. 215:818.[Medline]
-
Weber HC, Jensen RT. 1996 Pancreatic endocrine
tumors and carcinoid tumors: recent insights from genetic and molecular
biologic studies. In: Dervenis CG, ed. Advances in pancreatic disease.
Molecular biology, diagnosis and treatment. Stuttgart; New York: Thieme
Verlag; 5575.
-
Passaro E, Jr, Howard TJ, Sawicki MP, Watt PC, Stabile
BE. 1998 The origin of sporadic gastrinomas within the gastrinoma
triangle: a theory. Arch Surg. 133:1316.[Abstract/Free Full Text]
-
Donow C, Pipeleers-Marichal M, Schroder S, Stamm B,
Heitz PU, Kloppel G. 1991 Surgical pathology of gastrinoma: site,
size, multicentricity, association with multiple endocrine neoplasia
type 1, and malignancy. Cancer. 68:13291334.[CrossRef][Medline]
-
Evers BM, Rady PL, Sandoval K, et al. 1994 Gastrinomas demonstrate amplification of the HER-2/neu
proto-oncogene. Ann Surg. 219:596604.[Medline]
-
Fraker DL, Jensen RT. 1997 Pancreatic endocrine
tumors. In: DeVita VT, Hellman S, Rosenberg SA, eds. Cancer: principles
and practice of oncology. Philadelphia: Lippincott-Raven;
16781704.
-
Chung DC, Smith AP, Louis DN, Graeme-Cook F, Warshaw AL,
Arnold A. 1997 Analysis of the retinoblastoma tumour suppressor
gene in pancreatic endocrine tumours. Clin Endocrinol (Oxf). 47:523528.[CrossRef][Medline]
-
Chandrasekharappa SC, Guru SC, Manickam P, et al. 1997 Positional cloning of the gene for multiple endocrine
neoplasia-type 1. Science. 276:404407.[Abstract/Free Full Text]
-
Marx S, Spiegel AM, Skarulis MC, Doppman JL, Collins FS,
Liotta LA. 1998 Multiple endocrine neoplasia type 1:clinical and
genetic topics. Ann Intern Med. 129:484494.[Abstract/Free Full Text]
-
Zhuang Z, Vortmeyer AO, Pack S, et al. 1997 Somatic
mutations of the MEN1 tumor suppressor gene in sporadic gastrinomas and
insulinomas. Cancer Res. 57:46824686.[Abstract/Free Full Text]
-
Hessman O, Lindberg D, Skogseid B, et al. 1998 Mutation of the multiple endocrine neoplasia type 1 gene in
nonfamilial, malignant tumors of the endocrine pancreas. Cancer Res. 58:377379.[Abstract/Free Full Text]
-
Wang EH, Ebrahimi SA, Wu AY, Kashefi C, Passaro Jr E,
Sawicki MP. 1998 Mutation of the MENIN gene in sporadic pancreatic
endocrine tumors. Cancer Res. 58:44174420.[Abstract/Free Full Text]
-
Eng C, Clayton D, Schuffenecker I, et al. 1996 The
relationship between specific RET proto-oncogene mutations and disease
phenotype in multiple endocrine neoplasia type 2. JAMA. 276:15751579.[Abstract]
-
Fishbeyn VA, Norton JA, Benya RV, et al. 1993 Assessment and prediction of long-term cure in patients with
Zollinger-Ellison syndrome: the best approach. Ann Intern Med. 119:199206.[Abstract/Free Full Text]
-
Benya RV, Metz DC, Venzon DJ, et al. 1994 Zollinger-Ellison syndrome can be the initial endocrine manifestation
in patients with multiple endocrine neoplasia-type 1. Am J Med. 97:436444.[CrossRef][Medline]
-
Metz DC, Pisegna JR, Fishbeyn VA, Benya RV, Jensen
RT. 1993 Control of gastric acid hypersecretion in the management
of patients with Zollinger-Ellison syndrome. World J Surg. 17:468480.[CrossRef][Medline]
-
Gibril F, Doppman JL, Chang R, Weber HC, Termanini B,
Jensen RT. 1996 Metastatic gastrinomas: localization with
selective arterial injection of secretin. Radiology. 198:7784.[Abstract/Free Full Text]
-
Gibril F, Reynolds JC, Doppman JL, et al. 1996 Somatostatin receptor scintigraphy: its sensitivity compared with that
of other imaging methods in detecting primary and metastatic
gastrinomas: a prospective study. Ann Intern Med. 125:2634.[Abstract/Free Full Text]
-
Sugg SL, Norton JA, Fraker DL, et al. 1993 A
prospective study of intraoperative methods to diagnose and resect
duodenal gastrinomas. Ann Surg. 218:138144.[Medline]
-
Frucht H, Howard JM, Slaff JI, et al. 1989 Secretin
and calcium provocative tests in the Zollinger-Ellison syndrome: a
prospective study. Ann Intern Med. 111:713722.
-
Sarkar G, Yoon HS, Sommer SS. 1992 Dideoxy
fingerprinting (ddE): a rapid and efficient screen for the presence of
mutations. Genomics. 13:441443.[CrossRef][Medline]
-
Bonfils S, Landor JH, Mignon M, Hervoir P. 1981 Results of surgical management in 92 consecutive patients with
Zollinger-Ellison syndrome. Ann Surg. 194:692697.[Medline]
-
Mignon M, Ruszniewski P, Haffar S, Rignaud D, Rene E,
Bonfils S. 1986 Current approach to the management of tumoral
process in patients with gastrinoma. World J Surg. 10:703710.[CrossRef][Medline]
-
Mignon M, Jais P, Cadiot G, Yedder D, Vatier J. 1995 Clinical features and advances in biological diagnostic criteria
for Zollinger-Ellison syndrome. In: Mignon M, Jensen RT, eds. Endocrine
tumors of the pancreas: recent advances in research and management.
Basel: Karger; 223239.
-
Oberhelman HA, Jr, Nelsen TS, Johnson AN, Dragstedt
LR. 1961 Ulcerogenic tumors of the duodenum. Ann Surg. 153:214227.[Medline]
-
Hofmann JW, Fox PS, Wilson SD. 1973 Duodenal wall
tumors and the Zollinger-Ellison syndrome. Surgical management. Arch
Surg. 107:334339.[Medline]
-
Cadiot G, Lebtahi R, Sarda L, et al. 1996 Preoperative detection of duodenal gastrinomas and peripancreatic lymph
nodes by somatostatin receptor scintigraphy. Gastroenterology. 111:845854.[CrossRef][Medline]
-
Howard TJ, Zinner MJ, Stabile BE, Passaro E, Jr. 1990 Gastrinoma excision for cure. A prospective analysis. Ann Surg. 211:914.[Medline]
-
Giraud S, Zhang CX, Serova-Sinilnikova O, et al. 1998 Germ-line mutation analysis in patients with multiple endocrine
neoplasia type 1 and related disorders. Am J Hum Genet. 63:455467.[CrossRef][Medline]
-
Agarwal SK, Kester MB, Debelenko LV, et al. 1997 Germline mutations of the MEN1 gene in familial multiple endocrine
neoplasia type 1 and related states. Hum Mol Genet. 6:11691175.[Abstract/Free Full Text]
-
Shimizu S, Tsukada T, Futami H, et al. 1997 Germline mutations of the MEN1 gene in Japanese kindred with multiple
endocrine neoplasia type 1. Jpn J Cancer Res. 88:10291032.[CrossRef][Medline]
-
Metz DC, Jensen RT, Bale AE, et al. 1994 Multiple
endocrine neoplasia type 1:clinical features and management. In:
Bilezekian JP, Levine MA, Marcus R, eds. The parathyroids. New York:
Raven Press; 591646.
-
Darling TN, Skarulis MC, Steinberg SM, Marx SJ, Spiegel
AM, Turner M. 1997 Multiple facial angiofibromas and collagenomas
in patients with multiple endocrine neoplasia type 1. Arch Dermatol. 133:853857.[CrossRef][Medline]
-
Bassett JH, Forbes SA, Pannett AA, et al. 1998 Characterization of mutations in patients with multiple endocrine
neoplasia type 1. Am J Hum Genet. 62:232244.[CrossRef][Medline]
-
Knudson Jr AG. 1971 Mutation and cancer:
statistical study of retinoblastoma. Proc Natl Acad Sci USA. 68:820823.[Abstract/Free Full Text]
-
Heppner C, Kester MB, Agarwal SK, et al. 1997 Somatic mutation of the MEN1 gene in parathyroid tumours. Nat Genet. 16:375378.[CrossRef][Medline]
-
Farnebo F, Teh BT, Kytola S, et al. 1998 Alterations of the MEN1 gene in sporadic parathyroid tumors. J
Clin Endocrinol Metab. 83:26272630.[Abstract/Free Full Text]
-
Zhuang Z, Ezzat SZ, Vortmeyer AO, et al. 1997 Mutations of the MEN1 tumor suppressor gene in pituitary tumors. Cancer
Res. 57:54465451.[Abstract/Free Full Text]
-
Prezant TR, Levine J, Melmed S. 1998 Molecular
characterization of the men1 tumor suppressor gene in sporadic
pituitary tumors. J Clin Endocrinol Metab. 83:13881391.[Abstract/Free Full Text]
-
Sheffield VC, Beck JS, Kwitek AE, Sandstrom DW, Stone
EM. 1993 The sensitivity of single-strand conformation
polymorphism analysis for the detection of single base substitutions. Genomics. 16:325332.[CrossRef][Medline]
-
Kishi M, Tsukada T, Shimizu S, et al. 1998 A large
germline deletion of the MEN1 gene in a family with multiple endocrine
neoplasia type 1. Jpn J Cancer Res. 89:15.[CrossRef][Medline]
-
Herman Jg, Latif F, Weng Y, et al. 1994 Silencing
of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc Natl Acad Sci USA. 91:97009704.[Abstract/Free Full Text]
-
Muscarella P, Melvin WS, Fisher WE, et al. 1998 Genetic alterations in gastrinomas and nonfunctioning pancreatic
neuroendocrine tumors: an analysis of p16/MTS1 tumor suppressor gene
inactivation. Cancer Res. 58:237240.[Abstract/Free Full Text]
-
Agarwal SK, Guru SC, Heppner C, et al. 1999 Menin
interacts with the AP1 transcription factor JunD and represses
JunD-activated transcription. Cell. 96:143152.[CrossRef][Medline]
-
Sutliff VE, Doppman JL, Gibril F, et al. 1997 Growth of newly diagnosed, untreated metastatic gastrinomas and
predictors of growth patterns. J Clin Oncol. 15:24202431.[Abstract/Free Full Text]
-
Arnold R, Trautmann ME, Creutzfeldt W, et al. 1996 Somatostatin analogue octreotide and inhibition of tumour growth in
metastatic endocrine gastroenteropancreatic tumours. Gut. 38:430438.[Abstract/Free Full Text]
-
Ruttledge MH, Andermann AA, Phelan CM, et al. 1996 Type of mutation in the neurofibromatosis type 2 gene (NF2) frequently
determines severity of disease. Am J Hum Genet. 59:331342.[Medline]
-
Heshmati HM, Gharib H, Khosla S, Abu-Lebdeh HS, Lindor
NM, Thibodeau SN. 1997 Genetic testing in medullary thyroid
carcinoma syndromes: mutation types and clinical significance. Mayo
Clin Proc. 72:430436.[Medline]
-
Eng C, Mulligan LM. 1997 Mutations of the RET
proto-oncogene in the multiple endocrine neoplasia type 2 syndromes,
related sporadic tumours, and hirschsprung disease. Hum Mutat. 9:97109.[CrossRef][Medline]
-
Evans DG, Trueman L, Wallace A, Collins S, Strachan
T. 1998 Genotype/phenotype correlations in type 2
neurofibromatosis (NF2): evidence for more severe disease associated
with truncating mutations. J Med Genet. 35:450455.[Abstract/Free Full Text]
-
Arzimanoglou II, Gibbert F, Barber HR. 1998 Microsatellite instability in human solid tumors. Cancer. 82:18081820.[CrossRef][Medline]
-
Gayther SA, Warren W, Mazoyer S, et al. 1995 Germline mutations of the BRCA1 gene in breast and ovarian cancer
families provide evidence for a genotype-phenotype correlation. Nat
Genet. 11:428433.[CrossRef][Medline]
-
Zedenius J, Larsson C, Bergholm U, et al. 1995 Mutations of codon 918 in the RET proto-oncogene correlate to poor
prognosis in sporadic medullary thyroid carcinomas. J Clin
Endocrinol Metab. 80:30883090.[Abstract/Free Full Text]
-
Eng C, Mulligan LM, Smith DP, et al. 1995 Mutation
of the RET protooncogene in sporadic medullary thyroid carcinoma. Genes
Chromosom Cancer. 12:209212.[Medline]
-
Romei C, Elisei R, Pinchera A, et al. 1996 Somatic
mutations of the ret protooncogene in sporadic medullary thyroid
carcinoma are not restricted to exon 16 and are associated with tumor
recurrence. J Clin Endocrinol Metab. 81:16191622.[Abstract]
-
Rubie H, Hartmann O, Michon J, et al. 1997 N-myc gene amplification is a major prognostic factor in
localized neuroblastoma: results of the French NBL 90 study. J
Clin Oncol. 15:11711182.[Abstract/Free Full Text]
-
Irving RM, Harada T, Moffat DA, et al. 1997 Somatic
neurofibromatosis type 2 gene mutations and growth characteristics in
vestibular schwannoma. Am J Otol. 18:754760.[Medline]
-
Fearon ER, Vogelstein B. 1990 A genetic model for
colorectal tumorigenesis. Cell. 61:759767.[CrossRef][Medline]
-
Jensen RT. 1998 Somatostatin receptor scintigraphy
leads the way in gastrointestinal neuroendocrine tumors. Adv
Gastroentol Clin Nutr. 3:129131.
-
Jensen RT. 1997 Gastrin-producing tumors. Cancer
Treat Res. 89:293334.[Medline]
-
Beaudet AL, Tsui LC. 1993 A suggested nomenclature
for designating mutations. Hum Mutat. 2:245248.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
O Vierimaa, T M L Ebeling, S Kytola, R Bloigu, E Eloranta, J Salmi, E Korpi-Hyovalti, L Niskanen, A Orvola, E Elovaara, et al.
Multiple endocrine neoplasia type 1 in Northern Finland; clinical features and genotype phenotype correlation
Eur. J. Endocrinol.,
September 1, 2007;
157(3):
285 - 294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Furukawa, M. Raffeld, C. Mateo, A. Sakamoto, T. W. Moody, T. Ito, D. J. Venzon, J. Serrano, and R. T. Jensen
Increased Expression of Insulin-Like Growth Factor I and/or Its Receptor in Gastrinomas Is Associated with Low Curability, Increased Growth, and Development of Metastases
Clin. Cancer Res.,
May 1, 2005;
11(9):
3233 - 3242.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J W Cardinal, L Bergman, N Hayward, A Sweet, J Warner, L Marks, D Learoyd, T Dwight, B Robinson, M Epstein, et al.
A report of a national mutation testing service for the MEN1 gene: clinical presentations and implications for mutation testing
J. Med. Genet.,
January 1, 2005;
42(1):
69 - 74.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Asgharian, M. L. Turner, F. Gibril, L. K. Entsuah, J. Serrano, and R. T. Jensen
Cutaneous Tumors in Patients with Multiple Endocrine Neoplasm Type 1 (MEN1) and Gastrinomas: Prospective Study of Frequency and Development of Criteria with High Sensitivity and Specificity for MEN1
J. Clin. Endocrinol. Metab.,
November 1, 2004;
89(11):
5328 - 5336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Hao, M. C. Skarulis, W. F. Simonds, L. S. Weinstein, S. K. Agarwal, C. Mateo, L. James-Newton, G. R. Hobbs, F. Gibril, R. T. Jensen, et al.
Multiple Endocrine Neoplasia Type 1 Variant with Frequent Prolactinoma and Rare Gastrinoma
J. Clin. Endocrinol. Metab.,
August 1, 2004;
89(8):
3776 - 3784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Furlan, R. Cerutti, S. Uccella, S. La Rosa, E. Rigoli, A. Genasetti, and C. Capella
Different Molecular Profiles Characterize Well-Differentiated Endocrine Tumors and Poorly Differentiated Endocrine Carcinomas of the Gastroenteropancreatic Tract
Clin. Cancer Res.,
February 1, 2004;
10(3):
947 - 957.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Cavallari, D. M. D'Agostino, T. Ferro, A. Rosato, L. Barzon, C. Pasquali, P. Fogar, M. Theodoropoulou, G. Esposito, M. Boscaro, et al.
In Situ Analysis of Human Menin in Normal and Neoplastic Pancreatic Tissues: Evidence for Differential Expression in Exocrine and Endocrine Cells
J. Clin. Endocrinol. Metab.,
August 1, 2003;
88(8):
3893 - 3901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-J. Chen, A. Vortmeyer, Z. Zhuang, S. Huang, and R. T. Jensen
Loss of Heterozygosity of Chromosome 1q in Gastrinomas: Occurrence and Prognostic Significance
Cancer Res.,
February 15, 2003;
63(4):
817 - 823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. U. Goebel, M. Iwamoto, M. Raffeld, F. Gibril, W. Hou, J. Serrano, and R. T. Jensen
HER-2/neu Expression and Gene Amplification in Gastrinomas: Correlations with Tumor Biology, Growth, and Aggressiveness
Cancer Res.,
July 1, 2002;
62(13):
3702 - 3710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. L. Peghini, M. Iwamoto, M. Raffeld, Y.-J. Chen, S. U. Goebel, J. Serrano, and R. T. Jensen
Overexpression of Epidermal Growth Factor and Hepatocyte Growth Factor Receptors in a Proportion of Gastrinomas Correlates with Aggressive Growth and Lower Curability
Clin. Cancer Res.,
July 1, 2002;
8(7):
2273 - 2285.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Marx and L. K. Nieman
Aggressive Pituitary Tumors in MEN1: Do They Refute the Two-Hit Model of Tumorigenesis?
J. Clin. Endocrinol. Metab.,
February 1, 2002;
87(2):
453 - 456.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Brandi, R. F. Gagel, A. Angeli, J. P. Bilezikian, P. Beck-Peccoz, C. Bordi, B. Conte-Devolx, A. Falchetti, R. G. Gheri, A. Libroia, et al.
CONSENSUS: Guidelines for Diagnosis and Therapy of MEN Type 1 and Type 2
J. Clin. Endocrinol. Metab.,
December 1, 2001;
86(12):
5658 - 5671.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Guo and M. P. Sawicki
Molecular and Genetic Mechanisms of Tumorigenesis in Multiple Endocrine Neoplasia Type-1
Mol. Endocrinol.,
October 1, 2001;
15(10):
1653 - 1664.
[Abstract]
[Full Text]
[PDF]
|
 |
|