help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Goebel, S. U.
Right arrow Articles by Serrano, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Goebel, S. U.
Right arrow Articles by Serrano, J.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 1 116-123
Copyright © 2000 by The Endocrine Society


Original Studies

Genotype/Phenotype Correlation of Multiple Endocrine Neoplasia Type 1 Gene Mutations in Sporadic Gastrinomas

Stephan U. Goebel, Christina Heppner, A. Lee Burns, Stephen J. Marx, Allen M. Spiegel, Zhengping Zhuang, Irina A. Lubensky, Fathia Gibril, Robert T. Jensen and José Serrano

Digestive Diseases Branch (S.U.G., F.G., R.T.J., J.S.) and the Metabolic Diseases Branch (C.H., A.L.B., S.J.M., A.M.S.), National Institute of Diabetes and Digestive and Kidney Diseases, and the Laboratory of Pathology, National Cancer Institute (Z.Z., I.A.L.), National Institutes of Health, Bethesda, Maryland 20892

Address all correspondence and requests for reprints to: Dr. Robert T. Jensen, Digestive Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Building 10, Room 9C-103, 10 Center Drive, MSC 1804, Bethesda, Maryland 20892-1804.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Multiple endocrine neoplasia type 1 (MEN1) gene mutations are reported in some gastrinomas occurring in patients without MEN1 as well as in some other pancreatic endocrine tumors (PETs). In some inherited syndromes phenotype-genotype correlations exist for disease severity, location, or other manifestations. The purpose of the present study was to correlate mutations of the MEN1 gene in a large cohort of patients with sporadic gastrinomas to disease activity, tumor location, extent, and growth pattern. DNA was extracted from frozen gastrinomas from 51 patients and screened by dideoxyfingerprinting (ddF) for abnormalities in the 9 coding exons and adjacent splice junctions of the MEN1 gene. Tumor DNA exhibiting abnormal ddF patterns was sequenced for mutations. The findings were correlated with clinical manifestations of the disease, primary tumor site, disease extent, and tumor growth postoperatively. Tumor growth was determined by serial imaging studies. Sixteen different MEN1 gene mutations in the 51 sporadic gastrinomas (31%) were identified (11 truncating, 4 missense, and 1 in-frame deletion). Nine of the 16 mutations were located in exon 2 compared to 7 of 16 in the remaining 8 coding exons (P = 0.005 on a per nucleotide basis). Primary pancreatic or lymph node gastrinomas with a mutation had only exon 2 mutations, whereas duodenal tumors uncommonly harbored exon 2 mutations (P = 0.011). Similarly, small primary tumors (<1 cm) more frequently contained a nonexon 2 mutation (P = 0.02). There was no difference between patients with or without a mutation with respect to clinical characteristics, primary tumor site, disease extent, or proportion of patients disease free after surgery. Postoperative tumor growth tended to be more aggressive in patients with a mutation (P = 0.09). No correlation in the rate of disease-free status or postoperative tumor growth in patients with active disease to the location of the mutation was seen. These results demonstrate that the MEN1 gene is mutated in 31% of sporadic gastrinomas, and mutations are clustered between amino acids 66–166, which differs from patients with familial MEN1, in whom mutations occur throughout the gene. The presence of an MEN1 gene mutation does not correlate with clinical characteristics of patients with gastrinomas, gastrinoma extent, or growth pattern; however, the location of the mutation differed with gastrinoma location. These data suggest that mutations in the MEN1 gene are important in a proportion of sporadic gastrinomas, but the presence or absence of these mutations will not identify the clinically important subgroups with different growth patterns.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SINCE THE advent of effective gastric antisecretory drug treatment, the natural history of patients with sporadic Zollinger-Ellison syndrome has undergone a major change (1, 2, 3). Long term survival is now primarily governed by the tumor growth pattern and by its effective treatment, as opposed to the complications of only the ulcer disease that previously determined the clinical course (1, 2, 3). From recent studies (3, 4, 5, 6) it has become evident that about 40% of the patients undergoing a gastrinoma resection will remain permanently disease free, whereas 25% will experience a malignant course and may ultimately die from the tumor. Therefore, factors that determine the variable growth behavior of these tumors will have an increasingly important effect on the survival of patients with gastrinomas (3, 7). However, our understanding of the molecular changes that form the basis for this variability in growth is only rudimentary (7). For instance, the cell of origin of gastrinomas has not yet been identified, and recent speculations indicate that sporadic gastrinomas in different locations may actually originate from several different cell types (8). Furthermore, the primary site and the size of the primary tumor have been shown to be important determinants of the growth pattern (4, 9); however, the molecular basis for this remains unclear. Few studies of molecular abnormalities have shown convincing evidence for a pathogenic role in tumorigenesis in sporadic gastrinomas (7). Alterations of the ras oncogene, loss of heterozygosity at the Rb locus, or mutations of the p53 gene, which are important in the pathogenesis of many tumors, are rarely found in sporadic gastrinomas, other pancreatic endocrine tumors, or carcinoid tumors (7, 10, 11, 12). Amplification of the HER-2/neu protooncogene was found in virtually every gastrinoma in a small series (10); however, no data regarding protein expression or pathogenic mechanism were elucidated. The autosomal dominant syndrome multiple endocrine neoplasia type 1 (MEN1) is present in 25% of patients with gastrinomas. MEN1 is caused by mutations in a 10-exon gene on chromosome 11q13, resulting in alterations in the predicted 610-amino acid protein, menin (13, 14). Recent studies involving small numbers of pancreatic endocrine tumors and gastrinomas occurring in patients without MEN1 (15, 16, 17) suggest that mutations in the MEN1 gene occur in a proportion of these patients and therefore are probably important in their pathogenesis. In some inherited syndromes caused by alterations in tumor suppressor genes or oncogenes or in their sporadic counterparts, genotype/phenotype associations have been described (18), where different mutations affect disease severity, prognosis, or clinical expression. The existence of such relationships in patients with gastrinomas would have a profound effect on clinical management; however, it is presently unknown whether similar relationships exist in the case of mutations of the MEN1 gene in patients with sporadic gastrinomas. The purpose of the present study was, therefore, to correlate mutations of the MEN1 gene in a large cohort of patients with sporadic gastrinomas to clinical manifestations of gastrinomas, tumor location, extent, and growth pattern.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients and tumors

Fifty-one patients who underwent exploratory laparotomy for Zollinger-Ellison syndrome at the NIH between 1990 and 1998 were included in this study. The diagnosis of Zollinger-Ellison syndrome was established as previously reported (19), using measurements of fasting gastrin levels, basal acid output, secretin and calcium-provocative tests, and histological results. Patients with MEN1, diagnosed by family history or laboratory evidence of other endocrinopathies, determined as described previously (20), were excluded from the study. The study protocol was approved by the institutional review board of the NIDDK, and all patients gave informed consent.

To determine correlations of genetic alterations with clinical, laboratory, and tumor characteristics (growth, location, and size), the results from the following investigations performed on all patients were assessed. Measurement of basal acid output (BAO) and maximal acid output were performed as previously described (21). Fasting serum gastrin levels were determined in all patients and analyzed by RIA (Bioscience Laboratories, New York, NY) or Mayo Clinic Laboratories (Rochester, MN). The duration of disease determined in all patients was defined from the time of diagnosis or from the time of disease onset, as previously described (4). Detailed conventional imaging studies (computed tomography with oral and iv contrast, magnetic resonance imaging, ultrasound, selective abdominal angiography with secretin stimulation, and hepatic vein gastrin sampling) and somatostatin receptor scintigraphy were performed as previously reported (5, 22, 23) to locate the primary tumor and evaluate the extent of disease. All patients underwent exploratory laparotomy with an extensive intraoperative evaluation for attempted curative resection (5, 24). The patients were then reassessed within 2 weeks of surgery and 3–6 months postoperatively to determine disease-free status and annually to monitor progression of disease, as previously described (19). Disease-free status was defined by normal fasting gastrin levels (<200 pg/mL), negative results on gastrin provocative testing with secretin (<200 pg/mL increase) and calcium (<395 pg/mL increase), and no evidence of tumor on any imaging study (19, 25). Patients were classified as to whether they were disease free immediately postoperatively and at the last follow-up. In those patients who were not disease free postoperatively, annual detailed imaging studies (computed tomography, magnetic resonance imaging, ultrasound, and somatostatin receptor scintigraphy) provided the basis for assessment of tumor growth. Consistent absence of imagable lesions or lack of increase in size or number of lesions over the follow-up period was defined as a tumor not demonstrating growth. An increase in the size or number of lesions on imaging studies was defined as evidence of tumor growth. The new development of liver metastases during follow-up served as the definition for the liver metastases group.

Mutation analysis

Twenty-four patients had not had the MEN1 status of their gastrinomas previously assessed, and this was determined as described below. In 27 patients the MEN1 mutation status was known and previously reported (15); however, in that study no correlations with tumor phenotype genotype expression were performed. Tumor samples were immediately snap-frozen in liquid nitrogen during surgery and stored at -70 C. Tumor DNA was extracted from 8-µm cryosections of the specimens using a commercial kit (QiAamp blood kit, QIAGEN, Santa Clarita, CA) after analyzing an adjacent slide with hematoxylin and eosin staining to determine that there was no gross contamination with normal tissue. Germline DNA was extracted from leukocytes of these patients using the same kit.

Primers for amplification of exons 2–10 of the MEN1 gene were obtained according to the published sequences (http://www.nhgri.nih.gov). PCR was carried out in a final volume of 25 µL with 5–10 ng DNA and 0.5 µU DNA-polymerase (AmpliTaq Gold, Perkin-Elmer Corp., Foster City, CA) according to the manufacturer’s protocol. Dimethylsulfoxide in a final concentration of 5% was added to the PCR reactions for exons 2, 9, and 10. The PCR reaction was run under the following conditions: initial denaturation at 94 C for 10 min; 35 cycles of 94 C for 30 s, 60 C for 30 s, and 72 C for 2 min; and final extension at 72 C for 5 min in a thermal cycler (Perkin-Elmer Corp., 9600 thermocycler). PCR products were then subjected to dideoxyfingerprinting (ddF) as previously reported (26) using previously described primers (http://www.nhgri.nih.gov). The ddF reactions were run in nondenaturing gels (MDE, FMC Bioproducts, Rockland, ME) at 8 watts for 8 h. Subsequently, the gels were dried, and autoradiography was performed overnight. Samples with abnormal ddF patterns were subjected to direct sequencing using the same PCR primers and ddF primers for manual (AmpliCycle, Perkin-Elmer Corp.) and automated (ABI Prism, Perki- Elmer Corp.) sequencing. For those samples in which the mutated sequence could not be unambiguously identified on the sequencing gel, the primary PCR product was cloned in the vector pCR2.1 (TA-Cloning, Invitrogen, Carlsbad, CA) and resequenced.

Statistics

The {chi}2 test, Fisher’s exact test ,and Mann-Whitney rank test were used to compare the effects of MEN1 gene mutations on clinical and laboratory parameters and tumor characteristics. P < 0.05 was considered significantly different.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A total of 51 gastrinomas from 51 patients were studied. Clinical characteristics and laboratory values of the patients are shown in Table 1Go. This cohort is similar to other large series (2, 27, 28, 29) with respect to a slight male preponderance (57%), mean age of the patients (50 yr), and duration of disease, as defined by the time from onset of continuous symptoms until the surgery date (9 yr). Mean serum gastrin, preoperative BAO, and maximal acid output values are not significantly different from those in other large studies of patients with Zollinger-Ellison syndrome (29). Inhibition of gastric acid production at the time of surgery was achieved predominantly with H+-K+-adenosine triphosphatase inhibitors (omeprazole 45, lansoprazole 1). In contrast to older series (1, 2, 30, 31), but similar to other recent studies (32, 33), half of all identified primary tumors were located in the duodenum, and only 15% were found in the pancreas. The extent of the tumor encountered during surgery was comparable to that in other large surgical series (2), in that one third were confined to the primary site, another 33% included the primary site and spread to the lymph nodes, and only 8% had evidence of liver metastases during surgery.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical characteristics, laboratory values, and tumor location and extent in the patients studied

 
When tumor DNA was extracted from frozen tissue and analyzed by ddF and direct sequencing for mutations in the 9 coding exons and splice junctions of the MEN1 gene, we found 16 mutations in the 51 tumors examined (Fig. 1Go, left). No mutations were found in the corresponding leukocyte DNA. The mutations consisted of 2 nonsense, 4 missense (all leading to nonconservative amino acid changes), 9 deletions leading to frame shifts, and one in-frame deletion of 10 amino acids. Figure 2Go shows examples of a single base substitution leading to a nonsense mutation and a single base deletion leading to a frame shift. In Fig. 2aGo (top panel), the antisense strand of the mutation R98X (CGA->TGA) is shown in the gastrinoma tissue. The heterozygous state is due to amplification of the normal sequence from contaminating normal tissue, seen in the same patient’s leukocyte DNA (Fig. 2aGo, top panel). The antisense strand of the mutation 512delC in a gastrinoma is depicted in Fig. 2bGo (bottom panel). Figure 3Go shows a complex substitution detected by cloning of the normal and mutated allele (306AGCCCC->T). Three of the 16 mutations detected in our study have been previously found in the germline of familial MEN1 [R98X (34), 512delC (35), and 483delAT (36)]. Nine of the 16 mutations were located in exon 2, whereas the remaining 7 mutations were distributed throughout the other 8 coding exons (Fig. 1Go, left). This represents a significant overrepresentation of mutations per nucleotide (9 of 445 vs. 7 of 1381 nucleotides; P = 0.005) in exon 2. Furthermore, 11 of 16 (68%) mutations were found in the gene region encoding amino acids 66–166 (exons 2–3) of the 610-amino acid protein menin. We encountered several previously recognized polymorphisms [R171Q, 765–6(C->T), 1023–12(A->C), D418D, and A541T]. These polymorphisms include the three most common polymorphisms (35) found in familial MEN1.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Somatic mutations of the MEN1 gene in gastrinomas. The 10 exons of the MEN1 gene are shown diagrammatically. On the right the mutations reported by Wang et al. (17 ), regardless of type of mutation, are shown, and on the left the mutations found in this study are depicted. The mutation nomenclature follows standard reports (66 ). Deletions are numbered after the first deleted nucleotide, whereas amino acid changes are numbered after the respective codon. Deleted nucleotides are: 357del4, CTGT; 358del25, TGTCTATCATCGCCGCCCTCTATGC; 1212del7, GCCAATG; and 1733del30, AGCATCACCACCGCCGGAGGGTCCAGTGCT.

 


View larger version (39K):
[in this window]
[in a new window]
 
Figure 2. Sequence analysis of tumor DNA and corresponding leukocyte DNA from two gastrinoma patients showing two different somatic mutations (a base substitution or deletion) of the MEN1 gene. In the top panel (a), a single C for T substitution results in a nonsense mutation(CGA->TGA; R98X; antisense strand shown) is seen in the gastrinoma (arrow), but not in the leukocytes. In the bottom panel (b), the gastrinoma shows a single base deletion, 512delC (antisense strand shown), which is not seen in the leukocytes. Both tumor specimens show the mutated as well as faintly the normal allele, reflecting the presence of some normal tissue in the tumors.

 


View larger version (59K):
[in this window]
[in a new window]
 
Figure 3. Sequence analysis (antisense strand) from two clones showing the normal sequence (A) and in the gastrinoma a complex substitution (B; 306AGCCCC->T).

 
To assess a possible effect of the presence of a mutation in the MEN1 gene in patients with Zollinger-Ellison syndrome, we compared first the clinical characteristics and expressions of gastrinoma activity (gastrin level, gastrin change with secretin, and BAO) of patients with or without a MEN1 gene mutation in the gastrinoma (Table 2Go). No significant difference between the 2 groups was found regarding gender, age at surgery, or duration of disease determined from the time of diagnosis or from the onset of disease. Functional measures of the gastrinoma, including fasting serum gastrin level, the magnitude of the serum gastrin increase postsecretin, and the preoperative basal acid output, were not significantly different in the 2 groups. A similar analysis was performed to determine whether the presence or absence of a MEN1 gene mutation in the gastrinoma varied with primary tumor location or size, tumor extent, curability, or tumor growth pattern (Table 3Go). The primary tumor site was located most often in the duodenum in both groups (43% vs. 62%; Table 3Go), and the frequencies of the primary tumor location did not differ between the 2 groups. Although the resected tumors with mutations tended to be somewhat smaller in size than the tumors without a mutation, this difference did not reach statistical significance [50% vs. 26% (<1 cm); P = 0.08; Table 3Go]. Similarly, the tumor extent found intraoperatively did not differ between the 2 groups. Specifically, a similar proportion of patients had primary tumor only, lymph node metastases, or liver metastases found at surgical exploration (Table 3Go). Initially, more than half of all patients were disease free postresection in both groups (63% vs. 51%; Table 3Go). After a mean follow-up of 3.1 ± 0.5 yr, a similar proportion of patients (44% vs. 46%) remained disease free in both groups. The postoperative course in the patients with active disease showed a trend toward a more aggressive form, with evidence of tumor growth or development of new liver metastases in the group with a MEN1 mutation in the gastrinoma. However, this finding did not reach a statistically significant level (5 of 9 = 56% vs. 4 of 19 = 21%; P = 0.094).


View this table:
[in this window]
[in a new window]
 
Table 2. Comparison of clinical characteristics in patients with and without mutations of the MEN1 gene

 

View this table:
[in this window]
[in a new window]
 
Table 3. Comparison of tumor characteristics, results of surgery, and postoperative course in patients with or without mutations of the MEN1 gene in the gastrinoma

 
As the majority of mutations was located in exon 2 of the MEN1 gene (Fig. 1Go), we sought to analyze the tumor characteristics in those patients with such a mutation compared to those in patients with mutations at other locations (Table 4Go). Primary duodenal tumors more frequently had a nonexon 2 mutation (7 of 10) compared to pancreatic and lymph node primary tumors (0 of 5; P = 0.011). Nonexon 2 tumors were more frequently small in size (i.e. <1 cm; 6 of 7) compared to tumors with an exon 2 mutation (2 of 9; P = 0.02; Table 4Go). However, there was no difference in the rate of disease-free patients or the postoperative tumor growth pattern in the patients with active disease with or without exon 2 mutations.


View this table:
[in this window]
[in a new window]
 
Table 4. Comparison of tumor characteristics in patients with exon 2 and non-exon 2 mutations in the MEN1 gene

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The hereditary syndrome MEN1 is characterized by the occurrence of primary hyperparathyroidism (95–98%), pancreatic endocrine tumors (80–100%), pituitary adenomas (6–100%), gastric carcinoid tumors (13–30%), skin lesions (6–88%), and other, rarer, tumors (37, 38). The gene responsible for the familial syndrome was recently cloned and shown to be a 10-exon gene coding for the 610-amino acid protein menin, whose function remains unclear (13, 14). Mutations in the 9 coding exons or adjacent splice junctions have been identified in 75–95% of patients with familial MEN1 (fMEN1) (14, 34, 35, 39).

In tumors from patients without a hereditary tumor syndrome (sporadic disease), Knudson’s two-hit model of tumorigenesis postulates a somatic mutation of a tumor suppressor gene and somatic loss of the second allele via chromosomal breakage (40) or some other mechanism. Studies in parathyroid adenomas from patients without MEN1 show a frequency of somatic mutations of the MEN1 gene of 13–21% (41, 42). Sporadic pituitary adenomas only rarely (<5%) are found to harbor MEN1 gene mutations (43, 44). Previous studies of sporadic pancreatic endocrine tumors demonstrate somatic mutations in the MEN1 gene in 27–39% of the tumors (15, 16, 17). In keeping with the published frequency of somatic mutations in pancreatic endocrine tumors, we found 16 mutations in the MEN1 gene in sporadic gastrinomas from 51 patients (31%). Despite a reportedly high rate of loss of heterozygosity (93%) involving the MEN1 gene region in sporadic gastrinomas (15), we found no mutations in 35 gastrinomas. Several reasons can be hypothesized to explain this finding. First, it could be proposed that the screening methodology used lacks sensitivity. We employed ddF as the screening methodology. This technique has a reported sensitivity of more than 90% for detection of germline mutations (35), which is higher than the reported sensitivity of single strand conformation polymorphism to detect single base substitutions (80%) (45) that was used in a previous study (17). Moreover, in one study, direct sequencing of the entire open reading frame, albeit in a small number of sporadic pancreatic endocrine tumors, did not increase the rate of detected mutations in the MEN1 gene (16). Secondly, it is known that PCR-based strategies for mutational analysis can underestimate the rate of large deletions within a gene, i.e. deletion of the entire MEN1 gene, as has been reported in one family with MEN1 (46). A third reason could be the inactivation of gene expression by hypermethylation of the promotor region, as described in several other tumor suppressor genes (47, 48). This alteration would not be detected by the methodology used. Lastly, intron-based mutations may interfere with ribonucleic acid splicing or stability and reduce translational efficiency. However, the rate of detected mutations in this and recent (15, 17) studies confirms that the MEN1 gene probably plays a critical role in the pathogenesis of at least one third of sporadic gastrinomas.

A comparison of type and location of mutations in the MEN1 gene detected in sporadic gastrinomas in the present study and in other recent studies (15, 17) reveals a difference in the spectrum of mutations in the sporadic disease from that found in the MEN1 syndrome. Combining our data with results taken from the literature of other cases of sporadic gastrinomas (17), 40% of the 28 mutations described (8 missense and 3 in-frame deletions) are predicted to alter the amino acid sequence of menin. All amino acid substitutions were nonconservative. Seventeen mutations in sporadic gastrinomas are predicted to result in a truncated protein (60% of the total). The majority of mutations in fMEN1 lead to a truncated menin protein [103 of 141 (73%) germline mutations] (34, 35, 39) and probably loss of a functional protein. None of the observed missense mutations involves either of the two nuclear localization signals at the carboxyl-terminal end of the protein (47). Menin has been shown to interact with the transcription factor Jun-D (49). All missense mutations and in-frame deletions except two (1733del30 and S543L) are located in the putative menin binding region to Jun-D (0–323 amino acids) as found on deletion analysis (49) and conceivably could alter the interaction between these 2 proteins. The majority of all mutations in sporadic gastrinomas were located in the 5'-end of the coding region. In the nucleotide stretch from 300–610 (exons 2–3), corresponding to amino acids 66–166, we found 64% of the mutations compared to 36% in the remaining 1516 nucleotides. In contrast, the mutations in patients with fMEN1 are distributed rather evenly throughout the open reading frame regardless of the presence or absence of gastrinoma (35). It is conceivable that mutations involving the 3'-end of the coding region could lead to an abnormal protein that retains some wild-type function and may be less likely to promote tumorigenesis in sporadic gastrinomas. In fact, 6 of the 11 mutations leading to an intact protein with an altered amino acid sequence are within this region, possibly interfering with binding properties to potential interaction partners. Whether the clustering of mutations in this region is relevant for functional impairment of the menin protein in sporadic gastrinomas awaits further analysis of protein function.

Gastrinomas are not a homogeneous group of tumors. Not only do they differ in the primary location (duodenal, pancreas, and other sites), but also in clinical behavior, biological behavior, and growth pattern (25% pursue an aggressive course) (2, 3, 4, 50). Even in patients with liver metastases from progressive gastrinomas, the growth patterns are highly variable (50, 51), with 30% demonstrating no or minimal tumor growth, 30% having slow growth, and 40% having aggressive growth. The factors contributing to these different phenotypes are largely unknown. Genotype/phenotype correlations in hereditary tumor syndromes and a few sporadic tumors have at times suggested a relationship between the type or location of the mutation and the severity of the clinical disease or clinical expression of the disease. Examples of such associations in hereditary tumor syndromes have been described for MEN2 and neurofibromatosis type 2 (NF2) (18, 52). Specifically, mutations in the RET protooncogene are responsible for several different inherited tumor syndromes. Familial MEN2A and familial medullary thyroid cancer are usually caused by a mutation of one of five different codons coding for cysteine residues in exon 10 or 11 (18). Among these mutations, a mutation of codon 634 confers a higher risk of developing pheochromocytomas and hyperparathyroidism (18, 53). Furthermore, in patients with MEN2B, which is most frequently caused by the specific mutation M918T in exon 16 (54), a clinically more aggressive form of medullary thyroid cancer occurs than in MEN2A or familial medullary thyroid cancer. Thus, evidence of such a mutation in a patient with an inherited form of medullary thyroid cancer confers a higher risk of an aggressive course of the disease. Similarly, in NF2, truncating mutations of the NF2 gene are associated with a more severe disease phenotype (earlier onset and multiple tumors) compared to nontruncating mutations (52, 55). In other hereditary cancer syndromes (breast cancer and hereditary nonpolyposis colon cancer), no correlation between genotype and disease severity has been established (56, 57). In fMEN1, to date, no correlation between the location of the mutation or the type of mutation and clinical phenotype or severity of disease has been found (34, 35, 39). Our data suggest that there may be at least one genotype/phenotype correlation in sporadic gastrinomas. Comparison of the primary tumor site to location of the mutation revealed that nonduodenal primary tumors harbored only exon 2 mutations, whereas only 30% of the duodenal tumors did. This conclusion is based on relatively small numbers of gastrinomas (i.e. n = 16) and will need to be confirmed by larger studies in the future. This result is corroborated by the finding that 75% of the larger (>1-cm) primary tumors had an exon 2 mutation. As duodenal tumors are commonly small (<1 cm), and nonduodenal primary tumors are usually larger than 1 cm (2, 4, 5, 9), these results together suggest a relationship between the site of the MEN1 gene mutation and the location of the sporadic primary tumor.

In a few instances specific mutations of a gene thought to be involved in tumorigenesis of sporadic tumors correlate with the severity of the clinical disease (58, 59, 60, 61, 62). Hence, detection of such a mutation may serve as a prognostic marker and modify therapeutic strategies. In our study the presence of a mutation in the MEN1 gene in sporadic gastrinomas did not influence the rate patients were rendered disease free after surgery or the rate of tumor growth, although a trend toward a more aggressive course in the patients with active disease was observed (P = 0.09). Future studies involving a large number of patients and a long duration of follow-up may provide confirmation of this trend. Moreover, the type of mutation (data not shown) or location of the MEN1 gene mutation did not correlate with the rate of tumor growth. Therefore, no prediction about tumor extent or the postoperative growth behavior of the tumor could be made from MEN1 gene mutational analysis of the resected tumor. In contrast, analysis of the RET protooncogene in sporadic medullary thyroid carcinoma shows the mutation M918T to be present in 20–45% of the tumors and to be associated with a poor prognosis (58, 59, 60). Amplification of the N-myc gene in sporadic neuroblastomas appears to be a power-ful predictor of poor prognosis (61). In sporadic vestibular schwannomas, mutations of the NF2 gene are demonstrated in a similar frequency as MEN1 gene mutations in gastrinomas (38%) (62). Furthermore, the spectrum of mutations with regard to location or type of mutation is somewhat different from the reported germline mutations in NF2, analogous to our observations in the MEN1 gene. When the researchers attempted to correlate the presence of a mutation, location, or type of mutation to growth characteristics of the tumors, as measured by a calculated growth index or proliferating cell nuclear antigen immunostaining, no strong evidence for a correlation was found (62).

The reasons for the lack of correlation between the presence or site of a MEN1 gene mutation and the severity of disease in sporadic gastrinomas may be severalfold; sporadic gastrinomas, albeit clinically a biochemically homogenous syndrome, display a variable clinical course (2, 3, 9, 50) and thus may represent the common clinically apparent end point of diseases of various etiologies. This is underscored by the recently proposed concept of different embryonal origins of gastrinomas from different locations (8). Hence, different molecular alterations in the various cells of origin may lead to the common end point, a tumor secreting gastrin, and thereby differentially influence tumor growth patterns. Secondly, tumorigenesis has been proposed to be a multistep process, as exemplified in the colon cancer model (63), involving several successive molecular alterations that lead to the development of a tumor. Analogous to the colon cancer model, the frequency of mutations in the MEN1 gene in sporadic gastrinomas would suggest a possible role early in tumor development, but probably requires other genetic hits to explain the progression from the to date unknown progenitor cell to a gastrinoma. As an extension to this idea, a mutation of the MEN1 gene may promote the development of a sporadic gastrinoma, but factors further downstream in the evolution of the tumor may be responsible for the phenotypic expression of the disease, i.e. extent or metastases.

In summary, we find that the MEN1 gene is mutated in one third of sporadic gastrinomas. These mutations are clustered between nucleotides 300–610, in contrast to the finding in fMEN1, where they are more evenly distributed throughout the exons. The presence of a MEN1 gene mutation does not correlate with clinical characteristics, tumor extent, or growth behavior of the gastrinoma; however, there was a statistically significant correlation between the location of the MEN1 gene mutation and the primary gastrinoma location. Therefore, although the study confirms the importance of MEN1 gene mutations in sporadic gastrinomas, we could not establish a predictive value in the detection of a mutation regarding tumor growth patterns, which is one of the most important correlations that would directly affect clinical management (2, 4, 7, 50, 64, 65). Such predictive factors may arise from further understanding of the molecular steps involved in the pathogenesis of these tumors.

Received June 16, 1999.

Revised August 30, 1999.

Accepted September 1, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ellison EH, Wilson SD. 1964 The Zollinger-Ellison syndrome: re-appraisal and evaluation of 260 registered cases. Ann Surg. 160:512–530.[Medline]
  2. Jensen RT, Gardner JD. 1993 Gastrinoma. In: Go VLW, DiMagno EP, Gardner JD, Lebenthal E, Reber HA, Scheele GA, eds. The pancreas: biology, pathobiology and disease. New York: Raven Press; 931–978.
  3. Yu F, Venzon DJ, Serrano J, et al. 1999 Prospective study of the clinical course, prognostic factors and survival in patients with longstanding Zollinger-Ellison syndrome. J Clin Oncol. 17:615–630.[Abstract/Free Full Text]
  4. Weber HC, Venzon DJ, Lin JT, et al. 1995 Determinants of metastatic rate and survival in patients with Zollinger-Ellison syndrome: a prospective long-term study. Gastroenterology. 108:1637–1649.[CrossRef][Medline]
  5. Alexander HR, Fraker DL, Norton JA, et al. 1998 Prospective study of somatostatin receptor scintigraphy and its effect on operative outcome in patients with Zollinger-Ellison syndrome. Ann Surg. 228:228–238.[CrossRef][Medline]
  6. Norton JA, Doppman JL, Jensen RT. 1992 Curative resection in Zollinger-Ellison syndrome: results of a 10-year prospective study. Ann Surg. 215:8–18.[Medline]
  7. Weber HC, Jensen RT. 1996 Pancreatic endocrine tumors and carcinoid tumors: recent insights from genetic and molecular biologic studies. In: Dervenis CG, ed. Advances in pancreatic disease. Molecular biology, diagnosis and treatment. Stuttgart; New York: Thieme Verlag; 55–75.
  8. Passaro E, Jr, Howard TJ, Sawicki MP, Watt PC, Stabile BE. 1998 The origin of sporadic gastrinomas within the gastrinoma triangle: a theory. Arch Surg. 133:13–16.[Abstract/Free Full Text]
  9. Donow C, Pipeleers-Marichal M, Schroder S, Stamm B, Heitz PU, Kloppel G. 1991 Surgical pathology of gastrinoma: site, size, multicentricity, association with multiple endocrine neoplasia type 1, and malignancy. Cancer. 68:1329–1334.[CrossRef][Medline]
  10. Evers BM, Rady PL, Sandoval K, et al. 1994 Gastrinomas demonstrate amplification of the HER-2/neu proto-oncogene. Ann Surg. 219:596–604.[Medline]
  11. Fraker DL, Jensen RT. 1997 Pancreatic endocrine tumors. In: DeVita VT, Hellman S, Rosenberg SA, eds. Cancer: principles and practice of oncology. Philadelphia: Lippincott-Raven; 1678–1704.
  12. Chung DC, Smith AP, Louis DN, Graeme-Cook F, Warshaw AL, Arnold A. 1997 Analysis of the retinoblastoma tumour suppressor gene in pancreatic endocrine tumours. Clin Endocrinol (Oxf). 47:523–528.[CrossRef][Medline]
  13. Chandrasekharappa SC, Guru SC, Manickam P, et al. 1997 Positional cloning of the gene for multiple endocrine neoplasia-type 1. Science. 276:404–407.[Abstract/Free Full Text]
  14. Marx S, Spiegel AM, Skarulis MC, Doppman JL, Collins FS, Liotta LA. 1998 Multiple endocrine neoplasia type 1:clinical and genetic topics. Ann Intern Med. 129:484–494.[Abstract/Free Full Text]
  15. Zhuang Z, Vortmeyer AO, Pack S, et al. 1997 Somatic mutations of the MEN1 tumor suppressor gene in sporadic gastrinomas and insulinomas. Cancer Res. 57:4682–4686.[Abstract/Free Full Text]
  16. Hessman O, Lindberg D, Skogseid B, et al. 1998 Mutation of the multiple endocrine neoplasia type 1 gene in nonfamilial, malignant tumors of the endocrine pancreas. Cancer Res. 58:377–379.[Abstract/Free Full Text]
  17. Wang EH, Ebrahimi SA, Wu AY, Kashefi C, Passaro Jr E, Sawicki MP. 1998 Mutation of the MENIN gene in sporadic pancreatic endocrine tumors. Cancer Res. 58:4417–4420.[Abstract/Free Full Text]
  18. Eng C, Clayton D, Schuffenecker I, et al. 1996 The relationship between specific RET proto-oncogene mutations and disease phenotype in multiple endocrine neoplasia type 2. JAMA. 276:1575–1579.[Abstract]
  19. Fishbeyn VA, Norton JA, Benya RV, et al. 1993 Assessment and prediction of long-term cure in patients with Zollinger-Ellison syndrome: the best approach. Ann Intern Med. 119:199–206.[Abstract/Free Full Text]
  20. Benya RV, Metz DC, Venzon DJ, et al. 1994 Zollinger-Ellison syndrome can be the initial endocrine manifestation in patients with multiple endocrine neoplasia-type 1. Am J Med. 97:436–444.[CrossRef][Medline]
  21. Metz DC, Pisegna JR, Fishbeyn VA, Benya RV, Jensen RT. 1993 Control of gastric acid hypersecretion in the management of patients with Zollinger-Ellison syndrome. World J Surg. 17:468–480.[CrossRef][Medline]
  22. Gibril F, Doppman JL, Chang R, Weber HC, Termanini B, Jensen RT. 1996 Metastatic gastrinomas: localization with selective arterial injection of secretin. Radiology. 198:77–84.[Abstract/Free Full Text]
  23. Gibril F, Reynolds JC, Doppman JL, et al. 1996 Somatostatin receptor scintigraphy: its sensitivity compared with that of other imaging methods in detecting primary and metastatic gastrinomas: a prospective study. Ann Intern Med. 125:26–34.[Abstract/Free Full Text]
  24. Sugg SL, Norton JA, Fraker DL, et al. 1993 A prospective study of intraoperative methods to diagnose and resect duodenal gastrinomas. Ann Surg. 218:138–144.[Medline]
  25. Frucht H, Howard JM, Slaff JI, et al. 1989 Secretin and calcium provocative tests in the Zollinger-Ellison syndrome: a prospective study. Ann Intern Med. 111:713–722.
  26. Sarkar G, Yoon HS, Sommer SS. 1992 Dideoxy fingerprinting (ddE): a rapid and efficient screen for the presence of mutations. Genomics. 13:441–443.[CrossRef][Medline]
  27. Bonfils S, Landor JH, Mignon M, Hervoir P. 1981 Results of surgical management in 92 consecutive patients with Zollinger-Ellison syndrome. Ann Surg. 194:692–697.[Medline]
  28. Mignon M, Ruszniewski P, Haffar S, Rignaud D, Rene E, Bonfils S. 1986 Current approach to the management of tumoral process in patients with gastrinoma. World J Surg. 10:703–710.[CrossRef][Medline]
  29. Mignon M, Jais P, Cadiot G, Yedder D, Vatier J. 1995 Clinical features and advances in biological diagnostic criteria for Zollinger-Ellison syndrome. In: Mignon M, Jensen RT, eds. Endocrine tumors of the pancreas: recent advances in research and management. Basel: Karger; 223–239.
  30. Oberhelman HA, Jr, Nelsen TS, Johnson AN, Dragstedt LR. 1961 Ulcerogenic tumors of the duodenum. Ann Surg. 153:214–227.[Medline]
  31. Hofmann JW, Fox PS, Wilson SD. 1973 Duodenal wall tumors and the Zollinger-Ellison syndrome. Surgical management. Arch Surg. 107:334–339.[Medline]
  32. Cadiot G, Lebtahi R, Sarda L, et al. 1996 Preoperative detection of duodenal gastrinomas and peripancreatic lymph nodes by somatostatin receptor scintigraphy. Gastroenterology. 111:845–854.[CrossRef][Medline]
  33. Howard TJ, Zinner MJ, Stabile BE, Passaro E, Jr. 1990 Gastrinoma excision for cure. A prospective analysis. Ann Surg. 211:9–14.[Medline]
  34. Giraud S, Zhang CX, Serova-Sinilnikova O, et al. 1998 Germ-line mutation analysis in patients with multiple endocrine neoplasia type 1 and related disorders. Am J Hum Genet. 63:455–467.[CrossRef][Medline]
  35. Agarwal SK, Kester MB, Debelenko LV, et al. 1997 Germline mutations of the MEN1 gene in familial multiple endocrine neoplasia type 1 and related states. Hum Mol Genet. 6:1169–1175.[Abstract/Free Full Text]
  36. Shimizu S, Tsukada T, Futami H, et al. 1997 Germline mutations of the MEN1 gene in Japanese kindred with multiple endocrine neoplasia type 1. Jpn J Cancer Res. 88:1029–1032.[CrossRef][Medline]
  37. Metz DC, Jensen RT, Bale AE, et al. 1994 Multiple endocrine neoplasia type 1:clinical features and management. In: Bilezekian JP, Levine MA, Marcus R, eds. The parathyroids. New York: Raven Press; 591–646.
  38. Darling TN, Skarulis MC, Steinberg SM, Marx SJ, Spiegel AM, Turner M. 1997 Multiple facial angiofibromas and collagenomas in patients with multiple endocrine neoplasia type 1. Arch Dermatol. 133:853–857.[CrossRef][Medline]
  39. Bassett JH, Forbes SA, Pannett AA, et al. 1998 Characterization of mutations in patients with multiple endocrine neoplasia type 1. Am J Hum Genet. 62:232–244.[CrossRef][Medline]
  40. Knudson Jr AG. 1971 Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA. 68:820–823.[Abstract/Free Full Text]
  41. Heppner C, Kester MB, Agarwal SK, et al. 1997 Somatic mutation of the MEN1 gene in parathyroid tumours. Nat Genet. 16:375–378.[CrossRef][Medline]
  42. Farnebo F, Teh BT, Kytola S, et al. 1998 Alterations of the MEN1 gene in sporadic parathyroid tumors. J Clin Endocrinol Metab. 83:2627–2630.[Abstract/Free Full Text]
  43. Zhuang Z, Ezzat SZ, Vortmeyer AO, et al. 1997 Mutations of the MEN1 tumor suppressor gene in pituitary tumors. Cancer Res. 57:5446–5451.[Abstract/Free Full Text]
  44. Prezant TR, Levine J, Melmed S. 1998 Molecular characterization of the men1 tumor suppressor gene in sporadic pituitary tumors. J Clin Endocrinol Metab. 83:1388–1391.[Abstract/Free Full Text]
  45. Sheffield VC, Beck JS, Kwitek AE, Sandstrom DW, Stone EM. 1993 The sensitivity of single-strand conformation polymorphism analysis for the detection of single base substitutions. Genomics. 16:325–332.[CrossRef][Medline]
  46. Kishi M, Tsukada T, Shimizu S, et al. 1998 A large germline deletion of the MEN1 gene in a family with multiple endocrine neoplasia type 1. Jpn J Cancer Res. 89:1–5.[CrossRef][Medline]
  47. Herman Jg, Latif F, Weng Y, et al. 1994 Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc Natl Acad Sci USA. 91:9700–9704.[Abstract/Free Full Text]
  48. Muscarella P, Melvin WS, Fisher WE, et al. 1998 Genetic alterations in gastrinomas and nonfunctioning pancreatic neuroendocrine tumors: an analysis of p16/MTS1 tumor suppressor gene inactivation. Cancer Res. 58:237–240.[Abstract/Free Full Text]
  49. Agarwal SK, Guru SC, Heppner C, et al. 1999 Menin interacts with the AP1 transcription factor JunD and represses JunD-activated transcription. Cell. 96:143–152.[CrossRef][Medline]
  50. Sutliff VE, Doppman JL, Gibril F, et al. 1997 Growth of newly diagnosed, untreated metastatic gastrinomas and predictors of growth patterns. J Clin Oncol. 15:2420–2431.[Abstract/Free Full Text]
  51. Arnold R, Trautmann ME, Creutzfeldt W, et al. 1996 Somatostatin analogue octreotide and inhibition of tumour growth in metastatic endocrine gastroenteropancreatic tumours. Gut. 38:430–438.[Abstract/Free Full Text]
  52. Ruttledge MH, Andermann AA, Phelan CM, et al. 1996 Type of mutation in the neurofibromatosis type 2 gene (NF2) frequently determines severity of disease. Am J Hum Genet. 59:331–342.[Medline]
  53. Heshmati HM, Gharib H, Khosla S, Abu-Lebdeh HS, Lindor NM, Thibodeau SN. 1997 Genetic testing in medullary thyroid carcinoma syndromes: mutation types and clinical significance. Mayo Clin Proc. 72:430–436.[Medline]
  54. Eng C, Mulligan LM. 1997 Mutations of the RET proto-oncogene in the multiple endocrine neoplasia type 2 syndromes, related sporadic tumours, and hirschsprung disease. Hum Mutat. 9:97–109.[CrossRef][Medline]
  55. Evans DG, Trueman L, Wallace A, Collins S, Strachan T. 1998 Genotype/phenotype correlations in type 2 neurofibromatosis (NF2): evidence for more severe disease associated with truncating mutations. J Med Genet. 35:450–455.[Abstract/Free Full Text]
  56. Arzimanoglou II, Gibbert F, Barber HR. 1998 Microsatellite instability in human solid tumors. Cancer. 82:1808–1820.[CrossRef][Medline]
  57. Gayther SA, Warren W, Mazoyer S, et al. 1995 Germline mutations of the BRCA1 gene in breast and ovarian cancer families provide evidence for a genotype-phenotype correlation. Nat Genet. 11:428–433.[CrossRef][Medline]
  58. Zedenius J, Larsson C, Bergholm U, et al. 1995 Mutations of codon 918 in the RET proto-oncogene correlate to poor prognosis in sporadic medullary thyroid carcinomas. J Clin Endocrinol Metab. 80:3088–3090.[Abstract/Free Full Text]
  59. Eng C, Mulligan LM, Smith DP, et al. 1995 Mutation of the RET protooncogene in sporadic medullary thyroid carcinoma. Genes Chromosom Cancer. 12:209–212.[Medline]
  60. Romei C, Elisei R, Pinchera A, et al. 1996 Somatic mutations of the ret protooncogene in sporadic medullary thyroid carcinoma are not restricted to exon 16 and are associated with tumor recurrence. J Clin Endocrinol Metab. 81:1619–1622.[Abstract]
  61. Rubie H, Hartmann O, Michon J, et al. 1997 N-myc gene amplification is a major prognostic factor in localized neuroblastoma: results of the French NBL 90 study. J Clin Oncol. 15:1171–1182.[Abstract/Free Full Text]
  62. Irving RM, Harada T, Moffat DA, et al. 1997 Somatic neurofibromatosis type 2 gene mutations and growth characteristics in vestibular schwannoma. Am J Otol. 18:754–760.[Medline]
  63. Fearon ER, Vogelstein B. 1990 A genetic model for colorectal tumorigenesis. Cell. 61:759–767.[CrossRef][Medline]
  64. Jensen RT. 1998 Somatostatin receptor scintigraphy leads the way in gastrointestinal neuroendocrine tumors. Adv Gastroentol Clin Nutr. 3:129–131.
  65. Jensen RT. 1997 Gastrin-producing tumors. Cancer Treat Res. 89:293–334.[Medline]
  66. Beaudet AL, Tsui LC. 1993 A suggested nomenclature for designating mutations. Hum Mutat. 2:245–248.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
O Vierimaa, T M L Ebeling, S Kytola, R Bloigu, E Eloranta, J Salmi, E Korpi-Hyovalti, L Niskanen, A Orvola, E Elovaara, et al.
Multiple endocrine neoplasia type 1 in Northern Finland; clinical features and genotype phenotype correlation
Eur. J. Endocrinol., September 1, 2007; 157(3): 285 - 294.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Furukawa, M. Raffeld, C. Mateo, A. Sakamoto, T. W. Moody, T. Ito, D. J. Venzon, J. Serrano, and R. T. Jensen
Increased Expression of Insulin-Like Growth Factor I and/or Its Receptor in Gastrinomas Is Associated with Low Curability, Increased Growth, and Development of Metastases
Clin. Cancer Res., May 1, 2005; 11(9): 3233 - 3242.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J W Cardinal, L Bergman, N Hayward, A Sweet, J Warner, L Marks, D Learoyd, T Dwight, B Robinson, M Epstein, et al.
A report of a national mutation testing service for the MEN1 gene: clinical presentations and implications for mutation testing
J. Med. Genet., January 1, 2005; 42(1): 69 - 74.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Asgharian, M. L. Turner, F. Gibril, L. K. Entsuah, J. Serrano, and R. T. Jensen
Cutaneous Tumors in Patients with Multiple Endocrine Neoplasm Type 1 (MEN1) and Gastrinomas: Prospective Study of Frequency and Development of Criteria with High Sensitivity and Specificity for MEN1
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5328 - 5336.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. Hao, M. C. Skarulis, W. F. Simonds, L. S. Weinstein, S. K. Agarwal, C. Mateo, L. James-Newton, G. R. Hobbs, F. Gibril, R. T. Jensen, et al.
Multiple Endocrine Neoplasia Type 1 Variant with Frequent Prolactinoma and Rare Gastrinoma
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3776 - 3784.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. Furlan, R. Cerutti, S. Uccella, S. La Rosa, E. Rigoli, A. Genasetti, and C. Capella
Different Molecular Profiles Characterize Well-Differentiated Endocrine Tumors and Poorly Differentiated Endocrine Carcinomas of the Gastroenteropancreatic Tract
Clin. Cancer Res., February 1, 2004; 10(3): 947 - 957.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Cavallari, D. M. D'Agostino, T. Ferro, A. Rosato, L. Barzon, C. Pasquali, P. Fogar, M. Theodoropoulou, G. Esposito, M. Boscaro, et al.
In Situ Analysis of Human Menin in Normal and Neoplastic Pancreatic Tissues: Evidence for Differential Expression in Exocrine and Endocrine Cells
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3893 - 3901.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y.-J. Chen, A. Vortmeyer, Z. Zhuang, S. Huang, and R. T. Jensen
Loss of Heterozygosity of Chromosome 1q in Gastrinomas: Occurrence and Prognostic Significance
Cancer Res., February 15, 2003; 63(4): 817 - 823.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. U. Goebel, M. Iwamoto, M. Raffeld, F. Gibril, W. Hou, J. Serrano, and R. T. Jensen
HER-2/neu Expression and Gene Amplification in Gastrinomas: Correlations with Tumor Biology, Growth, and Aggressiveness
Cancer Res., July 1, 2002; 62(13): 3702 - 3710.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. L. Peghini, M. Iwamoto, M. Raffeld, Y.-J. Chen, S. U. Goebel, J. Serrano, and R. T. Jensen
Overexpression of Epidermal Growth Factor and Hepatocyte Growth Factor Receptors in a Proportion of Gastrinomas Correlates with Aggressive Growth and Lower Curability
Clin. Cancer Res., July 1, 2002; 8(7): 2273 - 2285.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. J. Marx and L. K. Nieman
Aggressive Pituitary Tumors in MEN1: Do They Refute the Two-Hit Model of Tumorigenesis?
J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 453 - 456.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. L. Brandi, R. F. Gagel, A. Angeli, J. P. Bilezikian, P. Beck-Peccoz, C. Bordi, B. Conte-Devolx, A. Falchetti, R. G. Gheri, A. Libroia, et al.
CONSENSUS: Guidelines for Diagnosis and Therapy of MEN Type 1 and Type 2
J. Clin. Endocrinol. Metab., December 1, 2001; 86(12): 5658 - 5671.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. S. Guo and M. P. Sawicki
Molecular and Genetic Mechanisms of Tumorigenesis in Multiple Endocrine Neoplasia Type-1
Mol. Endocrinol., October 1, 2001; 15(10): 1653 - 1664.
[Abstract] [Full Text] [PDF]


Home page